Epstein-Barr Virus (EBV) detection and typing by PCR: a contribution to diagnostic screening of EBV-positive Burkitt's lymphoma

Table 1 Primers used for EBNA2 PCR typing

Primers	Sequence (5'-3')	Use in the PCR reaction	EBNA-2 Location*
EBNA-2F	TGGAAACCCGTCACTCTC	1^st reaction sense	48572-89
EBNA-2I	TAATGGCATAGGTGGAATG	1^st reaction sntisense	49355-73
EBNA-2C	AGGGATGCCTGGACACAAGA	Nested reaction sense	48810-29
EBNA-2G	GCCTCGGTTGTGACAGAG	Nested reaction antisense type-1	49048-65
EBNA-2B	TTGAAGAGTATGTCCTAAGG	Nested reaction antisense type-2	2020-39#

* Sequence locations for type-1 correspond to B95.8 coordinates (Accession number V01555) and for type-2 (#) to AG876 isolate (Accession number K03332).

ISSN: 1746-1596