Skip to main content

Table 2 Quantitative methylation-specific PCR primer and TaqMan probe sequences used in the present study

From: Association of promoter methylation with histologic type and pleural indentation in non-small cell lung cancer (NSCLC)

Genes Forward primer sequence (5'→3') Probe sequence (5'→3') Reverse primer sequence (5'→3')
CALCA GTTTTGGAAGTATGAGGGTGACG 6FAM-ATTCCGCCAATACACAACAACCAATAAACG-TAMRA TTCCCGCCGCTATAAATCG
CDH1 AATTTTAGGTTAGAGGGTTATCGCGT 6FAM-CGCCCACCCGACCTCGCAT-TAMRA TCCCCAAAACGAAACTAACGAC
DAPK1 GGATAGTCGGATCGAGTTAACGTC 6FAM-TTCGGTAATTCGTAGCGGTAGGGTTTGG-TAMRA CCCTCCCAAACGCCGA
IRX2 GCGGGTCGTTTAGGTTAGTATTCG 6FAM-CCCTCCATCCACGCCCGACCGAAA-TAMRA CGCCGAACAACGAACAAAACG
TIMP3 GCGTCGGAGGTTAAGGTTGTT 6FAM-AACTCGCTCGCCCGCCGAA-TAMRA CTCTCCAAAATTACCGTACGCG
PAX6 ATATAGGACGGCGGTTTAGGTTG 6FAM-CCCAAAATCCGACCGACTCCAACCCCTA-TAMRA TTCCGACCGAACGAAAACCTAC
β-Actin TGGTGATGGAGGAGGTTTAGTAAGT 6FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRA AACCAATAAAACCTACTCCTCCCTTAA