Skip to main content

Table 1 Primers used for real-time PCR

From: Survivin regulates the expression of VEGF-C in lymphatic metastasis of breast cancer

Primer   5′-3′ sequence Size of PCR (bp)
Survivin forward TCATAGAGCTGCAGGGTGGATTGT 114
  reverse AGTAGGGTCCACAGCAGTGTTTGA  
VEGF-C forward AACCTCCATGTGTGTCCGTC 156
  reverse TGGCAAAACTGATTGTTACTGG  
GAPDH forward ACAGTCCATGCCATCACTGCC 266
  reverse GCCTGCTTCACCACCTTCTTG