Skip to main content

Table 2 Targeted Mutations and Pyrosequencing dispensing order for EGFR, KRAS and BRAF mutations

From: Pyrosequencing data analysis software: a useful tool for EGFR, KRAS, and BRAF mutation analysis

Targeted Mutations Pyrosequencing Dispensing Orders
EGFR exon 18, codon 719: CATGTCACTCGTG
EGFR exon 19 deletions CTATCACTGTCAGCTCGATCGTCATCGTCACGC
EGFR exon 20,
Codon 768 and insertions
GCAGTACGTGTCGTGTACGTGACCACACTG
EGFR exon 20, Codon 790 GATTCATCTG
EGFR exon 21 ACGTGTCACATGTC
KRAS codon 12 & 13 ACTGTACGTGATCGTAGCAAGAG
KRAS codon 61 (reverse sequencing) GCTCGATACGACCT
BRAF codon 600 (reverse sequencing) TCGTATCTGTAG