Skip to main content

Table 1 Sequences of primers and conditions used bisulfite PCR

From: Molecular characteristics and chromatin texture features in acute promyelocytic leukemia

Primers Sequences Temperature (°C) Enzyme
CDKN2B GGAGTTTAAGGGGGTGGG 58 BstUI
  CCTAAATTACTTCTAAAAAAAAAC
CDKN2A U TTATTAAGAGGGTGGGGTGGATTGT 60 -
  CAACCCCAAACCACAACCATAA   
CDKN2A M TTATTAGAGGGTGGGGCGGATCGC 60 -
  AGGGGATGTAGTGAAATTGGGGTTT   
TP73 U AGGGGATGTAGTGAAATTGGGGTTT 60 -
  ATCACAACCCCAAACATCAACATCCA   
TP73 M GGACGTAGCGAAATCGGGGTTC 60 -
  ACCCCGAACATCGACGTCCG