Skip to main content

Table 2 Sequence of p rimers and enzymes used in FLT3 reactions

From: Molecular characteristics and chromatin texture features in acute promyelocytic leukemia

Primers Sequence Enzyme
FLT3-ITD GCAATTTAGGTATGAAAGCCAGC -
  CTTTCAGCATTTTGACGGCAACC  
FLT3-TKD CCGCCAGGAACGTGCTTG EcoRV
  GCAGCCTCACATTGCCCC