Skip to main content

Table 1 RT-PCR probes

From: Effect of STAT5 silenced by siRNA on proliferation apoptosis and invasion of esophageal carcinoma cell line Eca-109

Names Probes Sequence
STAT5 Forward Primer 5’ GCTGGAAGCCTTGCTGAT 3’
  Reverse Primer 5’ TCCTCAAACGTCTGGTTGATC 3’
  Probe 5’ FAM-TGTCCCAGAAACACCTC–TAMRA 3’
Bcl2 Forward Primer 5’ CATGTGTGTGGAGAGCGTCAA 3’
  Reverse Primer 5’ GCCGGTTCAGGTACTCAGTCAT 3’
  Probe 5’ FAM-TGGACAACATCGCCCTGT–TAMRA 3’
Cyclin-D1 Forward Primer 5’ GTGGCCTCTAAGATGAAGGA 3’
  Reverse Primer 5’ GGTGTAGATGCACAGCTTCT 3’
  Probe 5’ FAM-ACCATCCCCCTGACGGC–TAMRA 3’
GAPDH Forward Primer 5’ GGTGGTCTCCTCTGACTTCAACA 3’
  Reverse Primer 5’ CCAAATTCGTTGTCATACCAGGAAATG 3’
  Probe 5’FAM-CGACACCCACTCCTCCACCTTTGACGC–TAMRA 3’
  1. The primers and probes were designed according to the software of Primer Express 3.0(ABI Corp), which all were synthetized by Shanghai bioengineering company, China.