Skip to main content

Advertisement

Table 1 List of all primers used and conditions of PCR amplification

From: Hypermethylation of EDNRB promoter contributes to the risk of colorectal cancer

  Primer Sequence (5′-3′) Product size (bp)
M F CGAAGAGGTTGCGGGCGGTATTAGCG 130
  R TACTCCAAAAACGTCCGATAACCG  
U F TGGTGAAGAGGTTGTGGGTGGTATTAGTG 134
  R ACCTACTCCAAAAACATCCAATAACCA  
RT-PCR    
  EDNRB-F GAAAGCCTCCGTGGGAATC 86
  EDNRB-R ACAGCTCGATATCTGTCAATACTCAGA  
  GAPDH-F CCATGGAGAAGGCTGGGG 194
  GAPDH-R CAAAGTTGTCATGGATGACC