Skip to main content

Table 2 Primers used in the study

From: RTEL1 tagging SNPs and haplotypes were associated with glioma development

SNP_ID 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences
rs2992 G/A ACGTTGGATGTCAAGTATCTGCTCTGTGGG ACGTTGGATGACTGGGTGCATCCTGAGAG cgatAGCAGGGGTGACGTATGTAGAA
rs12022378 C/T ACGTTGGATGAGATGCCTGGACCAGCTCT ACGTTGGATGCAATTACAGCCCACCTCTTG cctaaAGCCCACCTCTTGCATCGT
rs12917 T/C ACGTTGGATGCGAGGCTATCGAAGAGTTCC ACGTTGGATGAGATGGCTTAGTTACCGACC gctaGAAAACGGGATGGTGAA
rs12645561 T/C ACGTTGGATGTTACAGTTCTCTTTCACAG ACGTTGGATGGCAGAGCCTAGTTTCATGAC TTGCTCATTACTGTAAGAAATAATAC
rs7003908 C/A ACGTTGGATGGGGGAGAAAATATTCCTGTT ACGTTGGATGTCCTACCTCACGAACTCAGC AGCAATTGCCTAAGAGTC
rs6010620 G/A ACGTTGGATGGCCTGTTTTCCCTTTTTGAG ACGTTGGATGCCTCTCAACATCTCAGCAAC tGATCATGCAAAGCAGG
rs2297440 T/C ACGTTGGATGACGAGGTCTGGTGGCACAT ACGTTGGATGCACTGTCCTTTGCGTCCTC gtTCCTCCCTCACCAGC
rs4809324 C/T ACGTTGGATGGAGAAGTCAAGTGACATCAG ACGTTGGATGAGCCGGTGCACAGATTCCAA gagggCAAGGGCCTGGAATCTGT
rs3770502 A/G ACGTTGGATGCTATATGGGTGCAGATGCAG ACGTTGGATGACAGGCGTGAACCACTGTA ACCCGGCCCCTCCAC
rs9288516 A/T ACGTTGGATGACAGGCCAAGGGCAATAATC ACGTTGGATGGCTTCCTAAGATTTCCTATTC CATTTCAAAAGAAATGGAGAAT
  1. UEP Unextended mini-sequencing primer.