Skip to main content

Table 1 Sequences of primers and product size used in real time RT-PCR

From: Combined aberrant expression of E-cadherin and S100A4, but not β-catenin is associated with disease-free survival and overall survival in colorectal cancer patients

Gene Forward Backward size
E-cadherin AGTCACGCTGAATACAGTGG CATTTTCTGGGCAGCTGATG 161
N-cadherin CAGTGCAGTCTTATCGAAGG GAAAGCTTCTCACGGCATAC 158
β-catenin AATGGCAGTGCGTTTAGCTG ATAGCACCTTCAGCACTCTG 233
S100A4 CACAAGTACTCGGGCAAAGA TACACATCATGGCGATGCAG 211
GAPDH TGAGAACGGGAAGCTTGTCA GGAAGGCCATGCCAGTGA 258