Skip to main content

Table 1 The primer sequence used for genotyping

From: Association between STAT3 gene Polymorphisms and Crohn’s diseasesusceptibility: a case–control study in a Chinese Han population

rs2293152 Internal control forward primer CCGTTTAACCTAACTTCAT
Common reverse primer CCAGTTGTCTTTCATCCC
Specific primer C ACAAAGGGCCTCTGGCTGCC
Specific primer G ACAAAGGGCCTCTGGCTGCG
rs4796793 Internal control forward primer TCTGGTAGACACAGCTCAGTATGG
Common reverse primer CCATAGTCGCAGAGGTAGATTTTA
Specific primer C TGTTTAGTGATTTACTGCTTACAAAGG
Specific primer G TGTTTAGTGATTTACTGCTTACAAAGC
  Internal control forward primer TGCCTCTGCCTCTTTTCCTG
  Common reverse primer GATGGGACTTGGTGACTGACTG
  Specific primer C TGTCTTGAGGGAATCGAGCC
  Specific primer G ATGTCTTGAGGGAATCGAGCT