Skip to main content

Table 1 The primers pair sequences for MSP of RB1 and CDH1 and the amplicon sizes

From: Association between human papillomavirus and Epstein - Barr virus DNA and gene promoter methylation of RB1 and CDH1 in the cervical lesions: a transversal study

Primer Pair Sense 5′-3′ Antisense 5′-3′ Size (bp)
RBM GGGAGTTTCGCGGACGTGAC ACGTCGAAACACGCCCCG 172
RBU GGGAGTTTTGTGGATGTGAT ACATCAAAACACACCCCA 172
ECM GGTGAATTTTTAGTTAATTAGCGGTAC CATAACTAACCGAAAACGCCG 204
ECU GGTAGGTGAATTTTTAGTTAATTAGTGGTA ACCCATAACTAACCAAAAACACCA 211
  1. bp, base pair.