Skip to main content

Table 2 Pyrosequencing primers and parameters for genotyping the codons 600-BRAF and 61-NRAS

From: NRAS Q61R, BRAF V600E immunohistochemistry: a concomitant tool for mutation screening in melanomas

Gene PCR primers sequence (Forward and Reverse 5′ → 3′) Pyrosequencing primer Nucleotides dispensation order
BRAF Biotin-GCTTGCTCTGATAGGAAAATG GATGGGACCCACTCCATCGAGA GTCTACTGT
CCACAAAATGGATCCAGACA
NRAS ACACCCCCAGGATTCTTACAGA GACATACTGGATACAGCTGGA TCGTATCGAGAG
Biotin-GCCTGTCCTCATGTATTGGTC