Skip to main content

Table 1 ASPCR Primers

From: Quality control material for the detection of somatic mutations in fixed clinical specimens by next-generation sequencing

Amplicon Name Primer Sequence (5'-3') Amplicon Size (bp)
BRAF_conserved BRAF-F1: TGCTTGCTCTGATAGGA 241
BRAF_R: CTAGTAACTCAGCAGCA
BRAF_V600E BRAF-F2: TGGTCTAGCTACAGA 141
BRAF_R: CTAGTAACTCAGCAGCA
SMAD4_conserved SMAD4_F1: TTGTCTTTTCTTTAGGGC 286
SMAD4_R: AAGATAGTTCTTTTCTTTTGG
SMAD4_48586344_C > T SMD4_F2: ATTTAGTGGTGATTGAAAT 181
SMAD4_R: AAGATAGTTCTTTTCTTTTGG
RET_conserved RET_F1: GTGCTATTTTTCCTCACA 268
RET_R: AGGGCTATAAAAAGCTTAG
RET_43615612_A > G RET_F2: GCTTGTCCCGG 176
RET_R: AGGGCTATAAAAAGCTTAG