Skip to main content

Table 1 Primers used to detect the gene fusion product of Xp11.2 translocation RCC

From: An Xp11.2 translocation renal cell carcinoma with SMARCB1 (INI1) inactivation in adult end-stage renal disease: a case report

Name Primer (5' → 3')
β-actin(F) ATCACCATTGGCAATGAGCG
β-actin(R) TTGAAGGTAGTTTCGTGGAT
PSF-TFE3(F) TGGTGGTGGCATAGGTTATG
PSF-TFE3(R) CGTTTGATGTTGGGCAGCTC
NonO(p54nrb)-TFE3(F) GAGAAACTAGACACAGCAAC
NonO(p54nrb)-TFE3(R) CTTTCTTCTGCCGTTCCTTC
PRCC-TFE3(F) CCAAGCCAAAGAAGAGGA
PRCC-TFE3(R) AGTGTGGTGGACAGGTACTG
CLTC-TFE3(F) AGTCGCGTTGTTGGAAAGTATTGTG
CLTC-TFE3(R) CAAAAGGGCCTTTGCCTCGGTC
ASPSCR1-TFE3(F) AAAGAAGTCCAAGTCGGGCCA
ASPSCR1-TFE3(R) CGTTTGATGTTGGGCAGCTCA
Normal TFE3(exon3) (F) CCCGCAAGTGCCCAGCCACTG
Normal TFE3(exon4) (R) CAGTTCCTTGATCCTGTCG