Skip to main content

Table 2 Primer sequences

From: FOXM 1 induces Vasculogenic mimicry in esophageal cancer through β-catenin /Tcf4 signaling

GenesForward primer (5′-3′)Reverse primer (5′-3′)Length (bp)
FOXM1CGTCGGCCACTGATTCTCAAAGGCAGGGGATCTCTTAGGTTC96
TCF4TGCAAAGCCGAATTGAAGATCGAGAAGGTCCAATGATTCCATGC131
β-cateninATGGACAGTATGCAATGACTCGTAGCAGACACCATCTGAGGAGA345
E-cadherinGAAGTGTCC GAGGACTTTGGCAGTGTCTCTCCAAATCCGATA109
GAPDHCAGCCTCAAGATCATCAGCATGTGGTCATGAGTCCTTCCA106
FOXM1, TCF4, β-catenin, E-cadherin.