Skip to main content

Table 1 PCR primers used for Sanger sequencing

From: Pulmonary epithelial–myoepithelial carcinoma without AKT1, HRAS or PIK3CA mutations: a case report

Gene Direction Sequence (5′ to 3′)
AKT1 exon 2 Forward AGGCACATCTGTCCTGGCAC
Reverse AAATCTGAATCCCGAGAGGCC
CTNNB1 exon 3 Forward TTTGATGGAGTTGGACATGG
Reverse AAAATCCCTGTTCCCACTCA
HRAS exon 2 Forward CAGGCCCCTGAGGAGCGATG
Reverse TTCGTCCACAAAATGGTTCT
HRAS exon 3 Forward TCCTGCAGGATTCCTACCGG
Reverse GGTTCACCTGTACTGGTGGGA
PIK3CA exon 9 Forward TGACAAAGAAGAGCTCAAAGC
Reverse TTAGCACTTACCTGTGACTCCA
PIK3CA exon 20 Forward TGATGACATTGCATACATTCG
Reverse TGTGTGGAAGATCCAATCCA