Skip to main content

Table 2 Primer sequences and PCR amplification conditions for Sanger Sequencing (SS) validation

From: Quality assessment of a clinical next-generation sequencing melanoma panel within the Italian Melanoma Intergroup (IMI)

Gene Chromosome Position RefSeq Coding DNA Protein PCR primers Ta (°C) Length amplicon (bp)
CDKN2A chr9:21974792 NM_001195132 c.35delC p.(Ser12TrpfsTer14) F: ACTTCAGGGGTGCCACATTC 60 493
R: GCGCTACCTGATTCCAATTC
TP53 chr17:7579472 NM_000546.5 c.215C > G p.Pro72Arg F: TGAAGCTCCCAGAATGCCAG 60 136
R: GCTGCCCTGGTAGGTTTTCT
TP53 chr17:7577543 NM_000546.5 c.738G > A p.Met246Ile F: TGGCTCTGACTGTACCACCA 60 123
R: CAAGTGGCTCCTGACCTGG
ERBB4 chr2:212812278 NM_005235 c.298G > A p.Glu100Ly F: ACAGGCTACGTGTTAGTGGC 60 104
R:
GCCAAGGCATATCGATCCTCA
ERBB4 chr2:212578373 NM_005235 c.884A > T p.His295Leu F: TGTTTTGAGCTTGTTTGCTGA 60 176
R:
GGGCAAATGTCAGTGCAAGG
ARID2 chr12:46244997 NM_152641 c.3091C > T p.Gln1031Ter F: CGTCGTCCTCTACCCCTCAA 60 201
R:
CACCAGAGGCAGGCTGAC
KDR chr4:55972974 NM_002253 c.1416A > T p.Gln472His F: TACCATGGTAGGCTGCGTTG 60 191
R:
GGAAGTCCTCCACACTTCTCC
MET chr7:116340262 NM_001127500 c.1124A > G p.Asn375Ser F: ATTCTTTTCGGGGTGTTCGC 60 201
R:
TGGGGAACTGATGTGACTTACC
PIK3CA chr3:178927410 NM_006218 c.1173A > G p.Ile391Met F: AGGTGGAATGAATGGCTGAATTA 60 110
R: ACCTCTTTAGCACCCTTTCGG
PPP6C chr9:127912080 NM_001123355 c.790C > T p.Arg264Cys F: GGTGACAGTATGGTCTGCTCC 60 148
R: CGTTGTCGTTCTGGGAGGAA
BRAF chr7:140453136 NM_004333 c.1799 T > A p.Val600Glu F: GCTTGCTCTGATAGGAAAATGAGAT 60 175
R: CATCCACAAAATGGATCCAGACAAC
BRAF chr7:140453136 NM_004333 c.1798_1799delGTinsAA p.Val600Lys F: GCTTGCTCTGATAGGAAAATGAGAT 60 175
R: CATCCACAAAATGGATCCAGACAAC
BRAF chr7:140453135 NM_004333 c.1799_1800delTGinsAC p.Val600Asp F: GCTTGCTCTGATAGGAAAATGAGAT 60 175
R: CATCCACAAAATGGATCCAGACAAC
BRAF chr7:140453145 NM_004333 c.1790 T > G p.Leu597Arg F: GCTTGCTCTGATAGGAAAATGAGAT 60 175
R: CATCCACAAAATGGATCCAGACAAC
KIT chr4:55593464 NM_000222 c.1621A > C p.Met541Leu F: AGTGGCTGTGGTAGAGATCC 60 427
R: CAAAAAGGTGACATGGAAAGC
NRAS chr1:115256529 NM_002524 c.182A > G p.Gln61Arg F: CACCCCCAGGATTCTTACAG 60 173
R: TCCGCAAATGACTTGCTATT
NRAS chr1:115256530 NM_002524 c.181C > A p.Gln61Lys F: CACCCCCAGGATTCTTACAG 60 173
R: TCCGCAAATGACTTGCTATT
PTEN chr10:89720709 NM_000314 c.860C > G p.Ser287Ter F: GCAACAGATAACTCAGATTGC 60 505
R: TTCTTCATCAGCTGTACTCC
CDKN2A chr9:21971089 NM_001195132 c.256_268delGCCCGGGAGGGCT p.Ala86fs F: AGCTTCCTTTCCGTCATGC 60 0
R: GGAAGCTCTCAGGGTACAAAT
  1. Abbreviations: F primer Forward; R primer reverse; Ta annealing temperature