Skip to main content

Table 1 Primers used for the Sanger sequencing

From: An NRAS mutation in primary malignant melanoma of the lung: a case report

GeneExons5′ → 3′ SequenceTmLength
BRAFEX15F: TCATAATGCTTGCTCTGATAGG60224
R: GGCCAAAAATTTAATCAGTGG
NRASEX2F: GAAAGCTTTAAAGTACTGTAGATGTGG60247
R: AGATGATCCGACAAGTGAGAGA
NRASEX3F: CCCCTTACCCTCCACACC60243
R: CACAAAGATCATCCTTTCAGAGAA