Skip to main content

Table 1 Primer sequences were used in the study

From: hsa_circ_001946 elevates HOXA10 expression and promotes the development of endometrial receptivity via sponging miR-135b

Primers Sequences (5’-3’)
miR-135b-F CGCGTATGGCTTTTCATTC
miR-135b-R AGTGCAGGGTCCGAGGTATT
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
GAPDH-F TCAAGATCATCAGCAATGCC
GAPDH-R CGATACCAAAGTTGTCATGGA
hsa_circ_0001946-F TTGGGTCTGTCAGTGGACAA
hsa_circ_0001946-R GTCACACACCCACCACATTTC
HOXA10-F GGATTCCCTGGGCAATTCCA
HOXA10-R CTAATCTCTAGGCGCCGCTC
PRL-F AGGATCGCCATGGAAAGGGT
PRL-R GTCAAACAGGTCTCGAAGGGT
IGFBP1-F TGGGACGCCATCAGTACCTA
IGFBP1-R CTCCTGATGTCTCCTGTGCC