Skip to main content

Table 3 Primer sequences used in this study

From: miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p are sensitive biomarkers to diagnose sudden cardiac death

miRNAs Primer Sequences 5′-3′
hsa-miR-3113-5p GTCCTGGCCCTGGTCCGGGTCC
hsa-miR-499a-5p TTAAGACTTGCAGTGATGTTT
hsa-miR-223-3p TGTCAGTTTGTCAAATACCCCA
hsa-miR-133a-3p TTTGGTCCCCTTCAACCAGCTG