Gastric cancer with distinct Epstein–Barr virus-positive and -negative tumor components and their whole exome sequencing result: a case Report

Table 1 Pathogenic genomic variants found in EBV collision gastric cancer

Tumor area.	Chromosome	Position	Gene	Variant type	HGVS.c	Protein change	VAF
EBV-positive	Chr1	26,774,684	ARID1A	Frameshift mutation	c.4458_4477delGGCATCAGCTGAGGTTGCTC	p.Ser1488fs	0.059
EBV-positive	Chr17	70,175,263	KCNJ2	Missense mutation	c.224 C > T	p.Thr75Met	0.083
EBV-positive	chr11	14,358,803	RRAS2	Missense mutation	c.68G > T	p.Gly23Val	0.067
EBV-positive	chr15	44,715,574	B2M	Frameshift mutation	c.220_233delTTGTCTTTCAGCAA	p.Leu74fs	0.012
EBV-positive	Chr6	29,944,149	HLA-A	Frameshift mutation	c.650_651dupCC	p.Ile218fs	0.027
EBV-positive	chrX	45,089,874	KDM6A	Nonsense mutation	c.3836G > A	p.Trp1279*	0.139
EBV-negative	Chr1	26,774,684	ARID1A	Frameshift mutation	c.4458_4477delGGCATCAGCTGAGGTTGCTC	p.Ser1488fs	0.126
EBV-negative	Chr17	70,175,263	KCNJ2	Missense mutation	c.224 C > T	p.Thr75Met	0.203
EBV-negative	chr11	14,358,803	RRAS2	Missense mutation	c.68G > T	p.Gly23Val	0.175
EBV-negative	Chr3	179,218,294	PIK3CA	Missense mutation	c.1624G > A	p.Glu542Lys	0.078
EBV-negative	chr17	7,673,803	TP53	Missense mutation	c.817 C > T	p.Arg273Cys	0.272

ISSN: 1746-1596