Skip to main content

Table 1 H1 and H2 primers for VPH 16 intron E6

From: Losses of expression of the antigens A, Lea and Lex and over-expression of Ley in carcinomas and HG-SIL of the uterine cervix

Subtype HPV primers secuence (5'-3') product PCR
HPV 16 H1: ATT AGT GAG TAT AGA CAT TA 109 bp
  H2: GGC TTT TGA CAG TTA ATA CA  
HPV-16 E6 p1.- ATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTG