Skip to main content

Table 1 Specification of Primers used in RT-PCR and qRT-PCR Experiments

From: Expression of EBV Encoded viral RNA 1, 2 and anti-inflammatory Cytokine (interleukin-10) in FFPE lymphoma specimens: a preliminary study for diagnostic implication in Pakistan

S. No. Target Gene Primer Name Primer Sequence 5'-----------------3'
1) EBV encoded RNA 1 (EBER1) EB1 (Forward)
EB1 (Reverse)
5'- AGGACCTACGCTGCCCTAGA -3'
5'- AAAACATGCGGACCACCAGCTGG -3'
2) EBV encoded RNA 2 (EBER2) EB2 (Forward)
EB2 (Reverse)
5'- AGGACAGCCGTTGCCCTAGTG -3'
5'- TAGCGGACAAGCCGAATACCCT -3'
3) Interleukin 10 (IL10), mRNA IL-10 (Forward)
IL-10 (Reverse)
5'- ATGCACAGCTCAGCACTGCTCTG -3'
5'- GGAAGAAATCGATGACAGCGCCG -3'
4) Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), mRNA GAP (Forward)
GAP (Reverse)
5'- CAAGGTCATCCATGACAACTTTG -3'
5'- GTCCACCACCCTGTTGCTGTAG -3'