Skip to main content

Table 1 Targeted Mutations and Sequences for EGFR, KRAS and BRAF mutations

From: Pyrosequencing data analysis software: a useful tool for EGFR, KRAS, and BRAF mutation analysis

Targeted Mutations Targeted Sequences
EGFR exon 18, codon 719 DSCTCCGGTGC
EGFR exon 19 deletions TATCAA[GGAATTAAGAGAAGC]AACATCTCCGAAAGCCA
EGFR exon 20, Codon 768 CAGCGTGGACAACCCCCACG
EGFR exon 20, Codon 790 ATCAYG
EGFR exon 21 CKGGCCAAACDGCTGGGT
KRAS codon 12 & 13 NNTGRCGTAGGC
KRAS codon 61 (reverse sequencing) CTCDTGACCTG
BRAF codon 600 (reverse sequencing) CWCTGTAG
  1. Note: “D” could be A, T, U, or G (but not C); “S” could be C or G; “Y” could be C, T or U; “N” could any base; “R” could be A or G; “W”: T, U, or A. “[GGAATTAAGAGAAGC]” indicates deletion of the sequence.