Skip to main content

Table 1 Primers for amplification of virulence associated genes, Listeria spp. and serotypes of L. monocytogenes

From: Molecular characterization of Listeria monocytogenes isolated from fresh seafood samples in Iran

Primer name Primer sequence (5′-3′) Target Size of product (bp) References
Lis1B TTATACGCGACCGAAGCCAAC L. innocua 870 [26]
Ino2 ACTAGCACTCCAGTTGTTAAAC    
Lis1B TTATACGCGACCGAAGCCAAC L. 660 [26]
MonoA CAAACTGCTAACACAGCTACT monocytogenes   
Lis1B TTATACGCGACCGAAGCCAAC L. ivanovii 1100 [26]
Iva1 CTACTCAAGCGCAAGCGGCAC    
Lis1B TTATACGCGACCGAAGCCAAC L. seeligeri 1100 [26]
Sel1 TACACAAGCGGCTCCTGCTCAAC    
Lis1B TTATACGCGACCGAAGCCAAC L. welshimeri 1050 [26]
Wel1 CCCTACTGCTCCAAAAGCAGCG    
Lis1B TTATACGCGACCGAAGCCAAC L. grayi 480 [26]
MuraI GTGATTTCTGCTTGCCATAG    
prsF GCTGAAGAGATTGCGAAAGAAG All L. monocytogenes serovares 370 [27]
prsR CAAAGAAACCTTGGATTTGCGG    
lmo0737F AGGGCTTCAAGGACTTACCC L. monocytogenes serovar1/2a 691 [27]
lmo0737R ACGATTTCTGCTTGCCATTC    
ORF2819F AGCAAAATGCCAAAACTCGT L. monocytogenes serovar1/2b 471 [27]
ORF2819R CATCACTAAAGCCTCCCATTG    
ORF2110F AGTGGACAATTGATTGGTGAA L. monocytogenes serovar 4b 597 [27]
ORF2110R CATCCATCCCTTACTTTGGAC    
plc A-F CTGCTTGAGCGTTCATGTCTCCATCCCCC plcA gene 1484 [28]
plc A-R CATGGGTTTCACTCTCCTTCTAC    
prf A-F CTGTTGGAGCTCTTCTTGGTGAAGCAATCG prfA gene 1060 [28]
prf A-R AGCAACCTCGGTACCATATACTAACTC    
act A-F CGCCGCGGAAATTAAAAAAAGA actA gene 839 [29]
act A-R ACGAAGGAACCGGGCTGCTAG    
hly A-F GCAGTTGCAAGCGCTTGGAGTGAA hlyA gene 456 [30]
hly A-R GCAACGTATCCTCCAGAGTGATCG    
Iap-F ACAAGCTGCACCTGTTGCAG Iap gene 131 [31]
Iap-R TGACAGCGTGTGTAGTAGCA