Skip to main content

Table 1 Primers used in this study

From: Expression level of the growth factor progranulin is related with development of systemic lupus erythematosus

Gene Forward primers (5′-3′) Reverse primers (5′-3′)
PGRN gatcctgcgagaaggaagtg ggccagtaatgcaggct
IL-6 aggagacttgcctggtgaaa gtactgggaatcggtacg
PR3 ccatgcggcatagctataatt gacctttattggcgtacttc
TNFR accaagtgccacaaaggaac gcggtaccatattaaccgg
GAPDH cagaacatcatccctgcctctac ggcattccggtcgtgggc