Skip to main content

Table 2 The primer and TaqMan probe sequences used in this study

From: Low copy number of mitochondrial DNA (mtDNA) predicts worse prognosis in early-stage laryngeal cancer patients

Genes Forward primer sequence Probe sequence Reverse primer sequence Amplification
(5′ → 3′) (5′ → 3′) (5′ → 3′) Efficiency (%)
MT-ND1 CCCCTAAAACCCGCCACATC 6FAM-ACCCTCTACATCACCGCCCCGACC-TAMRA GTAGAAGAGCGATGGTGAGAGC 94.6
β-actin TCACCCACACTGTGCCCATCTACGA 6FAM-ATGCCCTCCCCCATGCCATCC-TAMRA TCGGTGAGGATCTTCATGAGGTA 95.2