Skip to main content

Advertisement

Table 1 Pfmdr1 PCR primer sequences and reaction conditions used in Fragments 1, 3 and 4 amplification reactions

From: Persistence of chloroquine-resistant haplotypes of Plasmodium falciparum in children with uncomplicated Malaria in Lagos, Nigeria, four years after change of chloroquine as first-line antimalarial medicine

Gene fragment Primer name   Primer sequence Codons PCR cycling conditions
Fragment 1      
Primary FR1 FN1/1 F 5′- AGGTTGAAAAAGAGTTGAAC-3′ 86, 184 94°C 3 min/[94°C 30 s-45°C 60 s 72°C 60 s]
  REV/C1 R 5′- ATGACACCACAAACATAAAT-3′   ×30 cycles
Nested FR1 MDR2/1 F 5′- ACAAAAAGAGTACCGCTGAAT -3′   72°C for 5 minutes/15°C 5 min
  NEWREV1 R 5′-AAACGCAAGTAATACATAAAGTC-3′   
Fragment 3      
Primary FR3 MDRFR3N1 F 5′-GCATTTTATAATATGCATACTG-3′ 1034, 1042 94°C 3 min/[94°C 30 s-55°C 60 s 65°C 40 s]
  MDRFR3R1 R 5′-GGATTTCATAAAGTCATCAAC-3′   ×30 cycles
Nested FR3 MDRFR3N2 F 5′-GGTTTAGAAGATTATTTCTGTA-3′   72°C 5 min/15°C 5 min
  MDRFR3R1 R 5′-GGATTTCATAAAGTCATCAAC-3′   
Fragment 4      
Primary FR4 MDRFR4N1 F 5′- CAAACCAATCTGGATCTGCAGAAG -3′ 1246 94°C 3 min/[94°C 30 s-55°C 60 s-65°C 40 s]
  MDRFR4R1 R 5′-CAATGTTGCATCTTCTCTTCC -3′   ×30 cycles
Nested FR4 MDRFR4N2 F 5′- GATCTGCAGAAGATTATACTG -3′   72°C 5 min/15°C 5 min
  MDRFR4R1 R 5′- CAATGTTGCATCTTCTCTTCC -3′   
  1. FR - Fragment F - forward R - Reverse.
  2. NB: Cycling conditions are the same for primary and nested PCRs.