Skip to main content

Table 3 Gene altered in MA

From: Novel clinicopathological and molecular characterization of metanephric adenoma: a study of 28 cases

Gene Number of mutation events (frequency) Exon_Rank Missense or stop-gained mutations Base mutation Synonymous or intronic mutations Base mutation
BRAF 23 15 p.V600E, LOC100507389-BRAF, STARD9-BRAF, CUX1-BRAF c.1799 T > A, chrom3:142634278_7:140492322, chrom15:42936216_7:140492968, chrom7:101809365_7:140492220 \ \
NF1 6 43, 46, 32 p.G1403S, p.Y2285* c.4207G > A, c.6855C > A p.S2152= c.6456 T > C
NOTCH1 5 29, 32, 14 p.D1808N, p.H2018Q, p.D740N c.5422G > A, c.6054C > A, c.2218G > A \ \
SPEN 5 11, 2 p.R807H, p.R128C c.2420G > A, c.382C > T p.K926= c.2778A > G
AKT2 4 NA \   cn_amp \
APC 4 16 p.L662I c.1984C > A p.P1634= c.4902G > A
ATRX 3 9 \ \ p.T899=, p.S651= c.2697G > A, c.1953 T > G
ETV4 3 NA \ \ cn_amp \
FANCD2 2 25, 30 p.N791S, p.T981I c.2372A > G, c.2942C > T \ \
FAT3 2 20, 23 p.R3849Q c.11546G > A p.Y4222= c.12666C > T
KDR 2 10, 15 p.W460 L, p.I753V c.1379G > T, c.2257A > G \ \
NOTCH3 2 4, 24 p.A198V c.593C > T p.P1331= c.3993G > A
TET2 2 11 p.E1973K, p.N1765 K c.5917G > A, c.5295C > G \ \
TSC2 2 30, 35, 5 p.V1144 M, p.E1513K c.3430G > A, c.4537G > A \ \
ABL1 1 4 \ \ p.L217= c.649 T > C
ALOX12B 1 12 p.A525T c.1573G > A \ \
AMER1 1 2 p.G149_A156del c.446_469delGAGCCACAGAGAAAGCTGTGGCTG \ \
ARID1A 1 1 \ \ p.A281= c.843G > A
ASXL1 1 12 p.Q778* c.2332C > T \ \
AURKB 1 6 p.G161R c.481G > A \ \
AXL 1 2 p.R71Q c.212G > A \ \
BCORL1 1 3 p.P312S c.934C > T \ \
CCND1 1 NA \ \ cn_amp \
CD79A 1 2 \ \ p.T65= c.195C > T
CDH1 1 9 p.D433N c.1297G > A \ \
CDK12 1 13 \ \ p.S1191= c.3573A > G
DIS3 1 11 p.V509 L c.1525G > C \ \
DOT1L 1 24 p.G1087S c.3259G > A \ \
EP300 1 2 \ \ p.Y207= c.621C > T
EPHA3 1 7 p.A515T c.1543G > A \ \
EPHA5 1 5 \ \ p.Y437= c.1311 T > C
ERBB2 1 3 \ \ p.P122= c.366G > A
ERBB4 1 27 p.A1130S c.3388G > T \ \
EZH2 1 2 p.R18C c.52C > T \ \
FGFR1 1 NA \ \ cn_amp NA
FGFR4 1 18 p.D785H c.2353G > C \ \
GRIN2A 1 3 p.V122I c.364G > A \ \
HRAS 1 4 \ \ p.D108= c.324C > T
IKBKE 1 6 p.R134C c.400C > T \ \
IL7R 1 5 p.A199G c.596C > G \ \
INHBA 1 2 p.K45R c.134A > G \ \
KAT6A 1 15 \ \ p.E993del c.2977_2979delGAG
KDM5A 1 23 \ \ p.G1200 fs c.3597dupA
KDM6A 1 5 p.Y143C c.428A > G \ \
KMT2D 1 10 \ \ p.P556= c.1668G > T
MAP2K1 1 10 p.Q354H c.1062A > C \ \
MET 1 NA \ \ cn_amp NA
MTOR 1 28 \ \ p.A1388= c.4164C > T
NCOR1 1 4 \ \ p.L133= c.399G > A
NF2 1 5 \ \ p.R160= c.478C > A
NPM1 1 7 p.V192 M c.574G > A \ \
NSD1 1 5 \ \ p.K513= c.1539G > A
NTRK1 1 8 p.N323S c.968A > G \ \
PAK3 1 1 p.S31G c.91A > G \ \
PARP2 1 8 p.E231K c.691G > A \ \
PARP4 1 31 \ \ p.R1332= c.3996C > T
PAX5 1 6 \ \ p.L234= c.700C > T
PIK3C2G 1 29 p.R1316G c.3946A > G \ \
PIK3CG 1 8 \ \ p.I879= c.2637C > T
PMS2 1 9 p.R304T c.911G > C \ \
PRDM1 1 5 p.H409Q c.1227C > A \ \
RAD52 1 9 p.A248T c.742G > A \ \
RET 1 7 \ \ p.G453= c.1359G > C
RPTOR 1 14 \ \ p.N513= c.1539C > T
SMARCA4 1 35 p.R1633Q c.4898G > A \ \
SOX10 1 4 p.T240P c.718A > C \ \
TSC1 1 13 p.M425 V c.1273A > G \ \
TSHR 1 5 p.G132R c.394G > C \ \
  1. Abbreviations: chrom chromosome, cn_amp copy number gain amplification, del deletion