Skip to main content

Table 1 The upstream primers and downstream primers for TLR4, MD-2, CXCR7 and GAPDH

From: LPS-induced CXCR7 expression promotes gastric Cancer proliferation and migration via the TLR4/MD-2 pathway

Gene Primer Sequence (5′ → 3′)
TLR4 Forward TGCAATGGATCAAGGACCAGAGG
Reverse TGCAGCCAGCAAGAAGCATCAG
MD-2 Forward CCGAGGATCTGATGACGATTA
Reverse GGCTCCCAGAAATAGCTTCAA
CXCR7 Forward CACAGCACAGCCAGGAAGG
Reverse GTTCCCTGGCTCTGAGTAGTCGA
GAPDH Forward GGATTTGGTCGTATTGGG
Reverse GGAAGATGGTGATGGGATT
  1. parameter cases TLR4+ P value MD-2+ P value CXCR7+ P value