Skip to main content

Table 1 Forward primer sequences used in this study

From: MicroRNA 3113-5p is a novel marker for early cardiac ischemia/reperfusion injury

miRNAs Primer Sequences 5′-3′
mmu-miR-146a-5p TGAGAACTGAATTCCATGGGTT
mmu-miR-150-5p TCTCCCAACCCTTGTACCAGTG
mmu-miR-202-3p AGAGGTATAGCGCATGGGAAGA
mmu-miR-30b-5p TGTAAACATCCTACACTCAGCT
mmu-miR-3968 CGAATCCCACTCCAGACACCA
mmu-miR-1224-5p GTGAGGACTGGGGAGGTGGAG
mmu-miR-188-5p CATCCCTTGCATGGTGGAG
mmu-miR-1895 CCGAGGAGGACGAGGAGGA
mmu-miR-1892 ATTTGGGGACGGGAGGGAGGAT
mmu-miR-327 ACTTGAGGGGCATGAGGAT
mmu-miR-3113-5p GTCCTGGCCCTGGTCCGGGTCC
mmu-miR-709 GAGGCAGAGGCAGGAGGAT
mmu-miR-223-3p TGTCAGTTTGTCAAATACCCCA
mmu-miR-154-5p TAGGTTATCCGTGTTGCCTTCG
mmu-miR-5121 AGCTTGTGATGAGACATCTCC