Skip to main content

Table 1 Primer sequences used for qPCR analyses

From: Low GSTM3 expression is associated with poor disease‐free survival in resected esophageal squamous cell carcinoma

Gene Sequence (5’->3’) Accession number
GSTM3 Forward sequence CCAATGGCTGGATGTGAA NM_000849.5
GAPDH Forward sequence ACTTCAACAGCGACACCCACTC NM_001256799.1