Table 1 Primer sequences for multiplex RT–PCR
From: Establishment of multiplex RT-PCR to detect fusion genes for the diagnosis of Ewing sarcoma
Primer name | 5′ ----- 3’ | RT-PCR | Sequencing | ||||
|---|---|---|---|---|---|---|---|
Set A | Set B | F mix (set A) | F mix (set B) | R mix | |||
EWSR1ex7_F (AF1) |
| gaacacctatgggcaaccga | ✔ | ✔ | |||
EWSR1ex4_F (BF1) |
| agaccgcctatgcaacttct | ✔ | ✔ | |||
FLI1ex9_R (R1) |
| ctcatcggggtccgtcattt | ✔ | ✔ | ✔ | ||
ERGex12_R (R2) |
| cgtcatcttgaactccccgt | ✔ | ✔ | ✔ | ||
ETV1ex11_R (R3) |
| atcctcgccgttggtatgtg | ✔ | ✔ | ✔ | ||
ETV4ex11_R (R4) |
| gaccccttcctgcttgatgt | ✔ | ✔ | ✔ | ||
FEVex2/3_R (R5) |
| gatctgtccgctgcctttct | ✔ | ✔ | ✔ | ||
FUSex5_F (AF2) |
| ggacagcagaaccagtacaaca | ✔ | ✔ | |||
FUSex3_F (BF2) |
| cggacagcagagttacagtgg | ✔ | ✔ | |||
