Open Access

Association between STAT3 gene Polymorphisms and Crohn’s diseasesusceptibility: a case–control study in a Chinese Han population

  • Zhengting Wang1,
  • Bin Xu1,
  • Hongxin Zhang2,
  • Rong Fan1,
  • Jie Zhou1 and
  • Jie Zhong1Email author
Contributed equally
Diagnostic Pathology20149:104

https://doi.org/10.1186/1746-1596-9-104

Received: 4 November 2013

Accepted: 11 May 2014

Published: 29 May 2014

Abstract

Background

Crohn’s disease (CD) is an immune-related disease with geneticpredisposition. This study aimed to investigate the association of threepolymorphisms in the signal transducer and activator of transcription 3(STAT3) gene with CD risk in a Chinese population.

Methods

We conducted a hospital-based case–control study involving 232 CDpatients and 272 controls. Genotyping was performed using polymerase chainreaction with sequence-specific primer method. Statistical analyses wereconducted using logistic regression and genotype risk scoring.

Results

Significant differences were found between patients and controls inallele/genotype distributions of rs744166(P allele = 0.0008;P genotype = 0.003) and allele distributions ofrs4796793 (P = 0.03). The risk for CD associated withthe rs744166-A mutant allele decreased by 37% [95% confidence interval (CI):0.48–0.83] under the additive model, 39% (95% CI: 0.43–0.81)under the dominant model and 57% (95% CI: 0.24–0.77) under therecessive model. Carriers of the rs4796793-G mutant allele exhibited 25%(95% CI: 0.58–0.98; P = 0.03) and 47% (95% CI:0.30–0.95) decreased risks of developing CD under the additive andrecessive models, respectively.

Conclusions

STAT3 rs744166 and rs4796793 polymorphisms may be associated with CDoccurrence and used as a predictive factor of CD in Chinese Hanpopulations.

Virtual Slides

The virtual slide(s) for this article can be found here:http://diagnosticpathology.slidepath.com/webViewer.php?snapshotId=1297687014

Keywords

STAT3PolymorphismCrohn’s diseasesSusceptibilityAssociation study

Background

Crohn’s disease (CD) and ulcerative colitis (UC) are inflammatory boweldiseases (IBDs). The etiology and pathogenesis of CD are not completely understood.However, familial aggregation and twin studies report that patients with CD carrystrong genetic predisposition [1]. Several studies also strongly suggest that CD results from a combinationof factors, such as commensal bacteria, food antigens, immunologic factors andmultiple genetic factors [2, 3]. The signal transducer and activator of transcription 3 (STAT3) gene is apotential candidate gene for CD for several reasons. STAT3 is a member of STATfamily, which possesses an important function in the development of human immunesystem and haematopoiesis. This gene has been associated with the signaltransduction pathway of multiple cytokines, including IL-2/γc, IL-6/gp130, IFNand IL-10 families, as well as IL-12, IL- 23, Flt3 ligand, M-CSF, G-CSF, leptin andgrowth hormone [49]. Several studies have highlighted that the STAT3 signaling pathway isimportant in the occurrence and development of IBD both in patients and animalmodels [1013].

In 2008, Barrett et al. [14] reported that the STAT3 locus is significantly associated with CDsusceptibility in a genome-wide association study (GWAS). Since then, a number ofstudies have demonstrated that the polymorphisms of STAT3 are associated with CD aswell as UC, but their results are not consistent in different population cohorts [1520]. Therefore, we performed an analysis on three polymorphisms (rs2293152,rs4796793 and rs744166) of STAT3 and CD in Chinese Han population.

Methods

Patient and control subjects

This hospital-based case–control study involved 232 CD patients and 272healthy controls of Chinese Han population recruited from the Department ofGastroenterology of Ruijin Hospital, which is connected with the ShanghaiJiaotong University School of Medicine between January 2009 and December 2010.Senior physicians diagnosed all patients based on clinical, endoscopic,radiological and histopathological findings in accordance with previouslyestablished international criteria [21]. All patients were followed up at least for 1 year andregistered with an integrated clinical and epidemiological registry. Controlswere randomly selected from healthy persons under routine health screening. Thepresent study was performed in accordance with the principles of Declaration ofHelsinki and approved by the Research Ethics Committee of Ruijin Hospital,Shanghai, China. Informed consent was obtained from all subjects before bloodsampling was carried out.

Genotyping

Genomic DNA was isolated from Ethylene Diamine Tetraacetic Acid (EDTA) peripheralblood using the QIAamp blood extraction kit (Qiagen, Hilden, Germany) followingthe manufacturer’s instructions. All DNA samples were genotyped for singlenucleotide polymorphisms by polymerase chain reaction with sequence-specificprimers (PCR-SSPs). All primers for the PCR-SSPs were designed using the genomicsequences in GenBank (http://www.ncbi.nlm.nih.gov). The primersequences are listed in Table 1. The amplifiedproducts were assessed for the presence/absence of PCR amplicons specific toparticular alleles using a standard 2% agarose gel electrophoresis, followed byethidium-bromide staining. About 10% of the samples were then confirmed bysequencing.
Table 1

The primer sequence used for genotyping

rs2293152

Internal control forward primer

CCGTTTAACCTAACTTCAT

Common reverse primer

CCAGTTGTCTTTCATCCC

Specific primer C

ACAAAGGGCCTCTGGCTGCC

Specific primer G

ACAAAGGGCCTCTGGCTGCG

rs4796793

Internal control forward primer

TCTGGTAGACACAGCTCAGTATGG

Common reverse primer

CCATAGTCGCAGAGGTAGATTTTA

Specific primer C

TGTTTAGTGATTTACTGCTTACAAAGG

Specific primer G

TGTTTAGTGATTTACTGCTTACAAAGC

 

Internal control forward primer

TGCCTCTGCCTCTTTTCCTG

 

Common reverse primer

GATGGGACTTGGTGACTGACTG

 

Specific primer C

TGTCTTGAGGGAATCGAGCC

 

Specific primer G

ATGTCTTGAGGGAATCGAGCT

Statistical analysis

For continuous and categorical variables, unpaired t-test andχ2 were conducted to compare CD patients and controls, respectively.To avoid gross genotyping error, all polymorphisms were evaluated forconsistency with Hardy–Weinberg equilibrium on a contingency table ofobserved-versus-predicted genotype frequencies by using Pearson χ2 test or Fisher's exact test. Genotypes were compared by logisticregression analysis under assumptions of additive, dominant and recessive modelsof inheritance. A P < 0.05 was considered statisticallysignificant.

Results

Table 2 shows detailed information of patients andcontrols. Cases and controls were well matched by age and gender distribution.
Table 2

Characteristics of CD patients and healthy controls in the Chinese Hanpopulation

Characteristics

CD patients

Control subjects

Number

232

272

Age, mean ± SD (years)

33.6 ± 13.5

46.4 ± 9.8

Age range (years)

20-70

18-70

Male /female

149/83

172/100

Smoking (%)

53 (22.84)

67 (24.63)

Drinking (%)

32 (13.79)

39 (14.34)

Appendectomy (%)

15 (6.47)

18 (6.62)

Family history of CD

0

0

The frequencies and distributions of alleles and genotypes at rs2293152, rs4796793and rs744166 STAT3 were identified and compared between CD patients and controls.The genotype distributions of the three polymorphisms of STAT3 were inHardy–Weinberg equilibrium in control groups(P > 0.05).

Table 3 shows that a significant difference was observedfor rs744166 between CD patients and controls both in allele and genotypedistributions (P allele = 0.0008, andP genotype = 0.003). A significant decreased risk was identifiedfor rs744166 in association with CD under the additive [odds ratio(OR) = 0.63; 95% confidence interval (CI): 0.48–0.83], dominant(OR = 0.61; 95% CI: 0.43–0.81) and recessive(OR = 0.43; 95% CI: 0.24–0.77) models.
Table 3

The genotype distributions and allele frequencies of the studiedpolymorphisms between patients and controls, and their risk predictionfor CD under three genetic models of inheritance

Polymorphism

CD group (%)

Healthy control (%)

 χ 2

 P

allele

CD group (%)

Healthy control (%)

 χ 2

 P

CD group HWe Pb

Healthy control HWe Pb

rs2293152

GG

58 (25.2)

78 (28.7)

  

G

253(55.0)

292(53.7)

    

CG

137 (59.6)

136(50)

5.16

0.08

C

207(45.0)

252(46.3)

0.18

0.67

0.21

0.93

CC

35 (15.2)

58 (21.3)

         

OR; 95% CI; P

Additive model: 094; (0.73,1.23); 0.66

Dominant model: 1.19; (0.8,1.77); 0.39

Recessive model: 0.66; (0.42,1.05); 0.08

rs4796793

CC

111 (47.8)

112 (41.2)

  

C

324 (69.8)

345 (63.4)

    
 

CG

102 (44.0)

121 (44.5)

5.38

0.07

G

140(30.2)

199 (36.6)

4.61

0.03

0.51

0.50

 

GG

19 (8.2)

39 (14.3)

         

OR; 95% CI; P

Additive model: 075; (0.58,0.98); 0.03

Dominant model: 0.76; (0.57,1.09); 0.13

Recessive model: 0.53; (0.30,0.95); 0.03

rs744166

TT

106(48)

98 (36.2)

  

T

309 (69.9)

323 (59.6)

    
 

CT

97(43.9)

127 (46.9)

11.62

0.003

C

133 (30.1)

219 (40.4)

11.28

0.0008

0.52

0.66

 

CC

18 (8.1)

46 (16.9)

         

OR; 95% CI; P

Additive model: 063; (0.48,0.83); <0.001

Dominant model: 0.61; (0.43,0.81); 0.008

Recessive model: 0.43; (0.24,0.77); 0.005

Abbreviations: HWe Hardy-Weinberg equilibrium. P values were calculated usingχ2 test 3 × 2 contingency table (†) forgenotype distributions and 2 × 2 contingency table(‡) for allele distributions.OR, 95%CI and P values werecalculated by logistic regression analysis.

As for rs4796793, a significant difference was observed between the two groups inallele but not in genotype distribution (P allele = 0.03 andP genotype = 0.07). Meanwhile, a significant decreased riskwas found in association with CD under the additive (OR = 0.75; 95% CI:0.58–0.98) and recessive (OR = 0.53; 95% CI: 0.30–0.95)models, whereas no significant association was detected under the dominant model(OR = 0.76; 95% CI: 0.57–1.09).

No significant difference was observed in the genotype and allele distributions ofrs2293152 between CD patients and controls. This result also agrees under theassumptions of the additive (OR = 0.94; 95% CI: 0.73–1.23),dominant (OR = 1.19; 95% CI: 0.80–1.77) and recessive(OR = 0.66; 95% CI: 0.42–1.05) models.

Discussion

CD is a relapsing inflammatory condition of gastrointestinal mucosal damage withcharacteristic extra-intestinal manifestations [22, 23]. CD is widely known as an immune-related disease with geneticpredisposition. Given the importance of immunity in CD, investigations onCD-susceptibility genes that involve immunity have attracted considerable attention [24, 25].

The STAT3 gene is located on chromosome 17q21. Its protein product is a member of theSTAT protein family that performs a dual function: signal transduction andtranscription activation. STAT3 is widely expressed and a latent cytoplasmictranscription factor that relays signals from the cell membrane directly to thenucleus. STAT3 becomes activated through phosphorylation on tyrosine as aDNA-binding protein in response to a variety of stimuli and mediates the expressionof a variety of genes. Thus, STAT3 possesses a key function in many biologicalpathways crucial to cell function, including proliferation, migration, survival anddifferentiation [26]. Several studies indicated that STAT3 activation plays distinctlydifferent roles between innate and acquired immune responses in colitis, that is,activation of STAT3 in innate immune cells enhances mucosal barrier function andSTAT3 activation in T-cells exacerbates colitis [11, 12]. A number of studies also suggest that polymorphisms of STAT3 areassociated with the susceptibility of CD or UC in some population cohorts [1520].

We examined three polymorphisms of STAT3 in 232 CD patients and 272 normal controlsof Chinese Han population. Results revealed that both the STAT3 gene alleles ofrs4796793G and rs744166C reduced the risk of CD occurrence and may have a protectivefunction in CD. To the authors' knowledge, this is the pilot study that explored thegenetic susceptibility of STAT3 gene to CD in a Chinese population.

The rs744166, which was first identified as an important candidate susceptibilitylocus for CD in a GWAS research [14], was confirmed in a Chinese population in this study. Our results are inagreement with those previously published data in a New Zealand population [17]. They found a significant decrease in the frequency of the G allele ofrs744166 in CD patients compared with controls (OR = 0.76, 95%CI = 0.61–0.95, P = 0.013), and G allele maybe protective against CD. However, Franke et al. [15] failed to replicate the association between rs744166 and CD risk in aGerman population. This discrepancy may be mostly due to the heterogeneous geneticpredispositions in people of different ethnicities. The genetic markers inpredisposition to IBD vary across geographical and racial groups. In our previousmeta-analyses, the CD14 gene C-260 T polymorphism exhibits remarkableheterogeneity with UC across ethnic groups, which is significant in Asians but notin Caucasians [27]. However, given the relatively small samples in this study, more studiesare required to reliably quantify the effect of rs744166.

rs2293152, a STAT3 variant, has been reported to be significantly associated with CDin Japanese population [16]. This variant did not show significant association between CD patient andnormal control groups in this study. Sample size may be one of the majordeterminants because both studies (Sato’s research and our study) selectedEast Asia population. Sato’s study only enrolled 83 CD cases and 200 healthycontrols, whereas our study included 232 CD cases and 272 normal controls. Given thelarger sample size, our result seems more reliable. We could not exclude thedifferent population results in different genetic backgrounds.

In the present study, a new candidate locus, rs4796793, was found, which wasassociated with CD in Chinese population. This association is not reported in otherstudies. Therefore, further studies should be carried out to verify this associationusing a large sample size from different ethnic origins and biological research.

This study has some drawbacks. First, the sample size was not very large; thus, moreSNP sites for pair-loci D'/r2 value analysis and haplotype analysis on a largernumber of Chinese subjects and on other ethnicities are necessary to confirm theassociation more clearly. Second, we only revealed limited polymorphisms of STAT3gene associated with susceptibility to CD, and other unidentified polymorphisms,which influenced the development of CD, may still exist. Third, our results werebased on unadjusted estimates. STAT3 gene polymorphisms of rs4796793 and rs744166individually make a protective contribution against CD, but whether thepolymorphisms integrated with other risk factors will change the prediction requiresadditional research. Thus, a more precise analysis should be conducted withindividual data, which would allow for the adjustment by other co-varieties, such asage, gender, lifestyle and other genetic factors.

Conclusion

In conclusion, this study is the first to demonstrate the single-marker associationof STAT3 with CD susceptibility in the Chinese Han population. We confirmed thatSTAT3 rs744166 and rs4796793 polymorphisms were associated with CD occurrence andused as a predictive factor of CD in Chinese Han populations.However, the diversegenetic profiles across different ethnic groups remain unclear.

Notes

Abbreviations

CD: 

Crohn’s disease

STAT3: 

Signal transducer and activator of transcription 3

CI: 

Confidence interval

UC: 

Ulcerative colitis

IBD: 

Inflammatory bowel disease

GWAS: 

Genome-wide association study

EDTA: 

Ethylene Diamine Tetraacetic Acid

PCR-SSPs: 

Polymerase chain reaction with sequence-specific primers

OR: 

Oddsratio.

Declarations

Authors’ Affiliations

(1)
Department of Gastroenterology, Ruijin Hospital, School of Medicine, Shanghai Jiaotong University
(2)
State Key Laboratory of Medical Genomics, Research Center for Experimental Medicine, Shanghai Institute of Hematology, Ruijin Hospital, Shanghai Jiaotong University School of Medicine

References

  1. Zheng CQ, Hu GZ, Zeng ZS, Lin LJ, Gu GG: Progress in searching for susceptibility gene for inflammatory bowel diseaseby positional cloning. World J Gastroenterol. 2003, 9 (8): 1646-1656.PubMedPubMed CentralView ArticleGoogle Scholar
  2. Molodecky NA, Kaplan GG: Environmental risk factors for inflammatory bowel disease. Gastroenterology hepatology(NY). 2010, 6 (5): 339-346.Google Scholar
  3. Cho JH: The genetics and immunopathogenesis of inflammatory bowel disease. Nat Rev Immunol. 2008, 8 (6): 458-466. 10.1038/nri2340.PubMedView ArticleGoogle Scholar
  4. Murray PJ: The JAK-STAT signaling pathway: input and output integration. J Immunol. 2007, 178 (5): 2623-2629. 10.4049/jimmunol.178.5.2623.PubMedView ArticleGoogle Scholar
  5. O'Shea JJ, Murray PJ: Cytokine signaling modules in inflammatory responses. Immunity. 2008, 28 (4): 477-487. 10.1016/j.immuni.2008.03.002.PubMedPubMed CentralView ArticleGoogle Scholar
  6. Akira S: Roles of STAT3 defined by tissue-specific gene targeting. Oncogene. 2000, 19 (21): 2607-2611. 10.1038/sj.onc.1203478.PubMedView ArticleGoogle Scholar
  7. Takeda K, Clausen BE, Kaisho T, Tsujimura T, Terada N, Förster I, Akira S: Enhanced Th1 activity and development of chronic enterocolitis in mice devoidof Stat3 in macrophages and neutrophils. Immunity. 1999, 10 (1): 39-49. 10.1016/S1074-7613(00)80005-9.PubMedView ArticleGoogle Scholar
  8. Stumhofer JS, Silver JS, Laurence A, Porrett PM, Harris TH, Turka LA, Ernst M, Saris CJ, O'Shea JJ, Hunter CA: Interleukins 27 and 6 induce STAT3-mediated T cell production of interleukin10. Nat Immunol. 2007, 8 (12): 1363-1371. 10.1038/ni1537.PubMedView ArticleGoogle Scholar
  9. Laouar Y, Welte T, Fu XY, Flavell RA: STAT3 is required for Flt3L-dependent dendritic cell differentiation. Immunity. 2003, 19 (6): 903-912. 10.1016/S1074-7613(03)00332-7.PubMedView ArticleGoogle Scholar
  10. Suzuki A, Hanada T, Mitsuyama K, Yoshida T, Kamizono S, Hoshino T, Kubo M, Yamashita A, Okabe M, Takeda K, Akira S, Matsumoto S, Toyonaga A, Sata M, Yoshimura A: CIS3/SOCS3/SSI3 plays a negative regulatory role in STAT3 activation andintestinal inflammation. J Exp Med. 2001, 193 (4): 471-481. 10.1084/jem.193.4.471.PubMedPubMed CentralView ArticleGoogle Scholar
  11. Musso A, Dentelli P, Carlino A, Chiusa L, Repici A, Sturm A, Fiocchi C, Rizzetto M, Pegoraro L, Sategna-Guidetti C, Brizzi MF: Signal transducers and activators of transcription 3 signaling pathway: anessential mediator of inflammatory bowel disease and other forms ofintestinal inflammation. Inflamm Bowel Dis. 2005, 11 (2): 91-98. 10.1097/00054725-200502000-00001.PubMedView ArticleGoogle Scholar
  12. Lovato P, Brender C, Agnholt J, Kelsen J, Kaltoft K, Svejgaard A, Eriksen KW, Woetmann A, Ødum N: Constitutive STAT3 activation in intestinal T cells from patients withCrohn's disease. J Biol Chem. 2003, 278 (19): 16777-16781. 10.1074/jbc.M207999200.PubMedView ArticleGoogle Scholar
  13. Li Y, de Haar C, Peppelenbosch MP, van der Woude CJ: New insights into the role of STAT3 in IBD. Inflamm Bowel Dis. 2012, 18 (6): 1177-1183. 10.1002/ibd.21884.PubMedView ArticleGoogle Scholar
  14. Barrett JC, Hansoul S, Nicolae DL, Cho JH, Duerr RH, Rioux JD, Brant SR, Silverberg MS, Taylor KD, Barmada MM, Bitton A, Dassopoulos T, Datta LW, Green T, Griffiths AM, Kistner EO, Murtha MT, Regueiro MD, Rotter JI, Schumm LP, Steinhart AH, Targan SR, Xavier RJ, Genetics Consortium NIDDKIBD, Libioulle C, Sandor C, Lathrop M, Belaiche J, Dewit O, Gut I, et al.: Genome-wide association defines more than 30 distinct susceptibility loci forCrohn's disease. Nat Genet. 2008, 40 (8): 955-962. 10.1038/ng.175.PubMedPubMed CentralView ArticleGoogle Scholar
  15. Franke A, Balschun T, Karlsen TH, Hedderich J, May S, Lu T, Schuldt D, Nikolaus S, Rosenstiel P, Krawczak M, Schreiber S: Replication of signals from recent studies of Crohn's disease identifiespreviously unknown disease loci for ulcerative colitis. Nat Genet. 2008, 40 (6): 713-715. 10.1038/ng.148.PubMedView ArticleGoogle Scholar
  16. Sato K, Shiota M, Fukuda S, Iwamoto E, Machida H, Inamine T, Kondo S, Yanagihara K, Isomoto H, Mizuta Y, Kohno S, Tsukamoto K: Strong evidence of a combination polymorphism of the tyrosine kinase 2 geneand the signal transducer and activator of transcription 3 gene as aDNA-based biomarker for susceptibility to Crohn's disease in the Japanesepopulation. J Clin Immunol. 2009, 29 (6): 815-825. 10.1007/s10875-009-9320-x.PubMedPubMed CentralView ArticleGoogle Scholar
  17. Ferguson LR, Han DY, Fraser AG, Huebner C, Lam WJ, Morgan AR, Duan H, Karunasinghe N: Genetic factors in chronic inflammation: single nucleotide polymorphisms inthe STAT-JAK pathway, susceptibility to DNA damage and Crohn's disease in aNew Zealand population. Mutat Res. 2010, 690 (1–2): 108-115.PubMedView ArticleGoogle Scholar
  18. Cénit MC, Alcina A, Márquez A, Mendoza JL, Díaz-Rubio M, de las Heras V, Izquierdo G, Arroyo R, Fernández O, de la Concha EG, Matesanz F, Urcelay E: STAT3 locus in inflammatory bowel disease and multiple sclerosissusceptibility. Genes Immun. 2010, 11 (3): 264-268. 10.1038/gene.2010.10.PubMedView ArticleGoogle Scholar
  19. Peter I, Mitchell AA, Ozelius L, Erazo M, Hu J, Doheny D, Abreu MT, Present DH, Ullman T, Benkov K, Korelitz BI, Mayer L, Desnick RJ, New York Crohn's Disease Working Group: Evaluation of 22 genetic variants with Crohn's disease risk in the AshkenaziJewish population: a case–control study. BMC Med Genet. 2011, 12: 63-PubMedPubMed CentralView ArticleGoogle Scholar
  20. Polgar N, Csongei V, Szabo M, Zambo V, Melegh BI, Sumegi K, Nagy G, Tulassay Z, Melegh B: Investigation of JAK2, STAT3 and CCR6 polymorphisms and their gene-geneinteractions in inflammatory bowel disease. Int J Immunogenet. 2012, 39 (3): 247-252. 10.1111/j.1744-313X.2012.01084.x.PubMedView ArticleGoogle Scholar
  21. Ouyang Q, Tandon R, Goh KL, Pan GZ, Fock KM, Fiocchi C, Lam SK, Xiao SD: Management consensus of inflammatory bowel disease for the Asia-Pacificregion. J Gastroenterol Hepatol. 2006, 21 (12): 1772-1782. 10.1111/j.1440-1746.2006.04674.x.PubMedView ArticleGoogle Scholar
  22. Matalka II, Al-Omari FA, Salama RM, Mohtaseb AH: A novel approach for quantitative assessment of mucosal damage ininflammatory bowel disease. Diagnostic Pathology. 2013, 8: 156-10.1186/1746-1596-8-156.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Larsen EP, Bayat A, Vyberg M: Small duct autoimmune sclerosing cholangitis and Crohn colitis in a10-year-old child. A case report and review of the literature. Diagnostic Pathology. 2012, 7: 100-10.1186/1746-1596-7-100.PubMedPubMed CentralView ArticleGoogle Scholar
  24. Wang ZT, Hu JJ, Fan R, Zhou J, Zhong J: RAGE gene three polymorphisms with Crohn's disease susceptibility in ChineseHan population. World J Gastroenterol. 2014, 20 (9): 2397-2402. 10.3748/wjg.v20.i9.2397.PubMedPubMed CentralView ArticleGoogle Scholar
  25. Wang L, Wang ZT, Hu JJ, Fan R, Zhou J, Zhong J: Polymorphisms of the vitamin D receptor gene and the risk of inflammatorybowel disease: a meta-analysis. Genet Mol Res. 2014, 13 (2): 2598-2610. 10.4238/2014.April.8.2.PubMedView ArticleGoogle Scholar
  26. Levy DE, Darnell JJ: Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol. 2002, 3 (9): 651-662. 10.1038/nrm909.PubMedView ArticleGoogle Scholar
  27. Wang Z, Hu J, Fan R, Zhou J, Zhong J: Association between CD14 gene C-260 T polymorphism and inflammatorybowel disease: a meta-analysis. PLoS One. 2012, 7: e45144-10.1371/journal.pone.0045144.PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Wang et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), whichpermits unrestricted use, distribution, and reproduction in any medium, provided theoriginal work is properly credited. The Creative Commons Public Domain Dedicationwaiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to thedata made available in this article, unless otherwise stated.

Advertisement