Open Access

Association of the interleukin-22 genetic polymorphisms with ulcerative colitis

  • Hong Gang Chi1,
  • Xue Bao Zheng1,
  • Zhu Guo Wu2,
  • Shi Xue Dai3,
  • Zheng Wan4 and
  • Ying Zou1, 4Email author
Diagnostic Pathology20149:183

https://doi.org/10.1186/s13000-014-0183-y

Received: 8 August 2014

Accepted: 7 September 2014

Published: 9 October 2014

Abstract

Background

Interleukin-22 (IL-22) is a member of the IL-10 family of anti-inflammatory cytokines that mediates epithelial immunity. IL-22 expression was found to be increased in patients with ulcerative colitis (UC). Whether genetic polymorphisms of IL-22 also influence UC risk is still unknown. The purpose of this study was to investigate the association between the IL-22 gene polymorphisms (-429 C/T, +1046 T/A and +1995 A/C) and the risk of UC in Chinese Han patients.

Methods

This hospital-based case-control study comprised 180 patients with UC and 180 age- and gender-matched controls. Genotypes of 3 common polymorphisms of the IL-22 gene were determined by fluorogenic 5′ exonuclease assays (TaqMan).

Results

Patients with UC had a significantly higher frequency of IL-22 -429 TT genotype [odds ratio (OR) =2.43, 95% confidence interval (CI) = 1.35, 4.37; P = 0.003] and -429 T allele (OR =1.54, 95% CI = 1.14, 2.07; P = 0.004) than controls. The findings are still emphatic by the Bonferroni correction. The IL-22 +1046 T/A and IL-22 +1995 A/C gene polymorphisms were not associated with a risk of UC. When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups.

Conclusion

This is the first study to provide evidence for an association of IL-22 -429 C/T gene polymorphisms with UC risk. Additional well-designed large studies were required for the validation of our results.

Virtual Slides

The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/13000_2014_183

Keywords

Interleukin-22 Gene polymorphism Ulcerative colitis case-control study

Background

Ulcerative colitis (UC), as the most common form of inflammatory bowel disease (IBD), is a form of colitis that includes characteristic ulcers, or open sores [1]. Ulcerative colitis has an incidence of 1 to 20 cases per 100,000 individuals per year, and a prevalence of 8 to 246 per 100,000 individuals [2]. Patients with UC have an increased risk of developing colorectal cancer [3]. The pathogenesis of UC is not well defined, but it is proposed that genetic and environmental factors result in an aberrant immune response to a subset of commensal enteric bacteria [4],[5]. Recent genome-wide association (GWA) studies and meta-analyses have identified many single-nucleotide polymorphisms (SNPs) associated with UC [6],[7].

Interleukin-22 (IL-22) is a member of the IL-10 family of anti-inflammatory cytokines that mediates epithelial immunity [8]. IL-22 is synthesized by different cell types including T- and NK-cells, and has been reported to mediate the crosstalk between inflammatory cells and keratinocytes [9]-[11]. IL-22 expression was induced in several human inflammatory conditions, including IBD [12],[13]. IL-22 expression was found to be increased in patients with UC [14]. Several SNPs have previously been identified in the IL-22 gene [15]-[22].

Whether genetic polymorphisms of IL-22 also influence UC risk is still unknown. The aim of this study was to investigate the association between the IL-22 gene polymorphisms (-429 C/T, +1046 T/A and +1995 A/C) and the risk of UC in Chinese Han patients.

Methods

Study subjects

This hospital-based case-control study comprised 180 patients with UC and 180 age- and gender-matched controls during the years 2009 to 2014. Diagnosis of UC was based on clinical, radiological, endoscopic and histological examinations [23]. To confirm the diagnosis, two physicians reviewed the hospital records and validated each case. The location of disease was defined according to the Montreal classification (ulcerative proctitis, left-sided colitis, and extensive colitis) [24]. The severity of UC was determined according to Truelove and Witts criteria (mild colitis, moderate colitis, and severe colitis) [25]. According to their clinical courses, UC cases were classified into one episode, relapsing and continuous phenotypes [26]. The control group was composed of age- and gender-matched subjects who had undergone an endoscopic examinations in the same recruitment period as the UC patients, without evidence of UC. In addition, similar to the cases the controls were all required to be born in China to native Chinese Han parents. Informed consent was obtained from all subjects after a full explanation of the project according to the Declaration of Helsinki, and the specimen collecting procedures were approved by the Institutional Ethical Committee of Guangdong Medical College.

Genotyping

Whole blood (3-6 ml) was obtained by venepuncture using standard EDTA collection tubes. DNA was extracted using the QIAGEN Gentra Puregene blood kit (QIAGEN Inc., Valencia, CA, USA). Genotypes of 3 common polymorphisms of the IL-22 gene were determined by fluorogenic 5' exonuclease assays (TaqMan). Primer and probe sequences for 5'-exonuclease assays for IL-22 polymorphisms were listed in Table 1. The polymerase chain reaction (PCR) was performed in a Primus 96 plus thermal cycler using a total volume of 5 μl containing 2.5 μl of Universal-MasterMix, 0.125 μl 40x Assay-by- Design mix, 0.375 μl H2O and 2 μl DNA. Reactions were overlaid with 15 μl of mineral oil. Cycling parameters were: 10 min at 94°C for primary denaturation, followed by 40 cycles of 20 s at 92°C and 1 min at 60°C. Fluorescence was measured in a lambda Fluoro 320 Plus plate reader (MWG Biotech AG, Germany).
Table 1

Primer and probe sequences for 5′-exonuclease assays for IL-22 polymorphisms

SNPs

rs2227485

rs1182844

rs1179246

Exchange

-429 C/T

+1046 T/A

+1995 A/C

Forward Primer

AAAATGAGTCCGTGACCAAAATGC

CCACCTATGAGACTTCCCTATCAGT

GAAAAAGCCTTCCTGCCTAATGG

Reverse Primer

ACACAATTGTTTTGTCTTAGTAGAGTTCAGAT

CACTAAAGGAAAAGGAAAGCTGTGTTT

GGTGCTGCCTAAAGGTCAGA

Wildtype-Probe

FAM-CTCCTATAGTGACTGAGTAA-NFQ

VIC-AAACTTACTAGTAGGTATGACTC-NFQ

VIC-TGAACAGAGTTATCTGCCTC-NFQ

Mutant-Probe

VIC-CTCCTATAGTGGCTGAGTAA-NFQ

FAM-CTTACTAGTAGGAATGACTC-NFQ

FAM-AACAGAGTTAGCTGCCTC-NFQ

Abbreviations: SNP single nucleotide polymorphisms.

Statistical analysis

STATA program version 11.0 (StataCorp LP, TX) was used for statistical analyses. Continuous variables were analysed by t-test and presented as mean-standard deviation (SD). Categorical variables are presented as percentages and were compared by chi-squared test. Odds ratio (OR) and 95% confidence intervals (CI) were determined by logistic regression analysis. For a new work, we also use the Bonferroni correction for total number of independent comparisons. The Hardy-Weinberg equilibrium was tested for goodness-of-fit chi-square test with one degree of freedom to compare the observed genotype frequencies among the subjects with the expected genotype frequencies. The P-value less than 0.05 was considered statistically significant.

Results

Characteristics of participants

Demographic and clinical characteristics of study participants were showed in Table 2. No significant differences were found between the UC cases and controls in age, sex, body mass index (BMI), smoking status and family history of inflammatory bowel disease (IBD) (Table 2). The genotype were in agreement with the Hardy-Weinberg equilibrium.
Table 2

Demographic and clinical characteristics of study participants

 

UC

Controls

P

Number of subjects

180

180

 

Sex (Male/Female)

95/85

98/82

0.75

Age (years, mean ± SD)

39.7 ± 12.5

40.2 ± 13.1

0.71

BMI (kg/m2, mean ± SD)

20.2 ± 3.7

19.8 ± 3.5

0.29

Smoking status (Ever/Never)

79/101

75/105

0.67

Family history of IBD (Positive/Negative)

14/166

11/169

0.54

Clinical type

   

One episode

16

  

Relapsing

70

  

Continuous

94

  

Location

   

Proctitis (E1)

73

  

Left side (E2)

64

  

Extensive (E3)

43

  

Disease severity

   

Mild

76

  

Moderate

95

  

Severe

9

  

Abbreviations: UC ulcerative colitis, BMI body mass index, IBD inflammatory bowel disease.

IL-22-429C/T polymorphisms and UC

Patients with UC had a significantly higher frequency of IL-22 -429 TT genotype (OR =2.43, 95% CI = 1.35, 4.37; P = 0.003) and -429 T allele (OR =1.54, 95% CI = 1.14, 2.07; P = 0.004) than controls (Table 3). The findings are still emphatic by the Bonferroni correction. When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups (Table 4).
Table 3

Genotype and allele frequencies of IL-22 gene polymorphisms among ulcerative colitis cases and healthy controls

Genotypes

UC (n = 150)

Controls (n = 150)

OR (95% CI)

P

-429 CC

57(31.7)

68(37.8)

1.00(Reference)

 

-429 CT

70(38.9)

86(47.8)

0.97(0.61,1.56)

0.90

-429 TT

53(29.4)

26(14.4)

2.43(1.35,4.37)

0.003

-429 C allele frequency

184(51.1)

222(61.7)

1.00(Reference)

 

-429 T allele frequency

176(48.9)

138(38.3)

1.54(1.14,2.07)

0.004

+1046 TT

88(48.9)

94(52.2)

1.00(Reference)

 

+1046 TA

63(35.0)

61(33.9)

1.10(0.70,1.74)

0.67

+1046 AA

29(16.1)

25(13.9)

1.24(0.67,2.28)

0.49

+1046 T allele frequency

239(66.4)

249(69.2)

1.00(Reference)

 

+1046 A allele frequency

121(33.6)

111(30.8)

1.14(0.83,1.55)

0.43

+1995 AA

76(42.2)

81(45.0)

1.00(Reference)

 

+1995 AC

65(36.1)

63(35.0)

1.10(0.69,1.75)

0.69

+1995 CC

39(21.7)

36(20.0)

1.16(0.67,2.00)

0.61

+1995 A allele frequency

217(60.3)

225(62.5)

1.00(Reference)

 

+1995 C allele frequency

143(39.7)

135(37.5)

1.10(0.81,1.48)

0.54

Abbreviations: UC ulcerative colitis, OR odds ratio, CI confidence interval.

Table 4

Stratification analysis of IL-22 -429 C/T polymorphisms in ulcerative colitis cases

 

Cases (n = 180)

CC

CT

TT

n (%)

OR (95% CI)

P

n (%)

OR (95% CI)

P

n (%)

OR (95% CI)

P

Clinical type

180

57(31.7)

1(Reference)

 

70(38.9)

1(Reference)

 

53(29.4)

1(Reference)

 

One episode

16

5(31.2)

0.99(0.35,2.81)

0.98

7(43.8)

1.13(0.44,2.85)

0.80

4(25.0)

0.85(0.27,2.65)

0.78

Relapsing

70

24(34.3)

1.08(0.62,1.88)

0.78

26(37.1)

0.96(0.56,1.62)

0.87

20(28.6)

0.97(0.54,1.74)

0.92

Continuous

94

28(29.8)

0.94(0.56,1.58)

0.82

37(39.4)

1.01(0.63,1.62)

0.96

29(30.8)

1.05(0.63,1.76)

0.86

Location

180

57(31.7)

1(Reference)

 

70(38.9)

1(Reference)

 

53(29.4)

1(Reference)

 

Proctitis (E1)

73

24(32.9)

1.04(0.60,1.80)

0.89

27(37.0)

0.95(0.57,1.60)

0.85

22(30.1)

1.02(0.58,1.80)

0.94

Left side (E2)

64

20(31.3)

0.99(0.55,1.77)

0.97

26(40.6)

1.05(0.61,1.78)

0.87

18(28.1)

0.96(0.52,1.75)

0.88

Extensive (E3)

43

13(30.2)

0.96(0.48,1.90)

0.89

17(39.6)

1.02(0.54,1.90)

0.96

13(30.2)

1.03(0.51,2.05)

0.94

Disease severity

180

57(31.7)

1(Reference)

 

70(38.9)

1(Reference)

 

53(29.4)

1(Reference)

 

Mild

76

25(32.9)

1.04(0.61,1.79)

0.89

28(36.8)

0.95(0.57,1.58)

0.84

23(30.3)

1.03(0.59,1.80)

0.92

Moderate

95

29(30.5)

0.96(0.58,1.61)

0.89

38(40.0)

1.03(0.65,1.64)

0.91

28(29.5)

1.00(0.59,1.68)

0.99

Severe

9

3(33.3)

1.05(0.28,4.02)

0.94

4(44.5)

1.14(0.34,3.83)

0.83

2(22.2)

0.76(0.16,3.60)

0.72

Abbreviations: OR odds ratio, CI confidence interval.

IL-22 +1046 T/A polymorphisms and UC

The IL-22+1046 T/A gene polymorphisms were not associated with a risk of UC (Table 3). When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups (Table 5).
Table 5

Stratification analysis of IL-22 + 1046 T/A polymorphisms in ulcerative colitis cases

 

Cases (n = 180)

TT

TA

AA

n (%)

OR (95% CI)

P

n (%)

OR (95% CI)

P

n (%)

OR (95% CI)

P

Clinical type

180

88(48.9)

1(Reference)

 

63(35.0)

1(Reference)

 

29(16.1)

1(Reference)

 

One episode

16

7(43.7)

0.89(0.35,2.55)

0.81

6(37.6)

1.07(0.40,2.86)

0.89

3(18.7)

1.16(0.32,4.25)

0.82

Relapsing

70

33(47.1)

0.96(0.59,1.57)

0.88

26(37.2)

1.06(0.62,1.81)

0.83

11(15.7)

0.98(0.46,2.06)

0.95

Continuous

94

48(51.1)

1.04(0.68,1.61)

0.84

31(33.0)

0.94(0.57,1.55)

0.82

15(15.9)

0.99(0.51,1.94)

0.98

Location

180

88(48.9)

1(Reference)

 

63(35.0)

1(Reference)

 

29(16.1)

1(Reference)

 

Proctitis (E1)

73

37(50.7)

1.04(0.65,1.66)

0.88

25(34.2)

0.98(0.57,1.67)

0.94

11(15.1)

0.94(0.44,1.97)

0.86

Left side (E2)

64

33(51.6)

1.06(0.65,1.72)

0.83

21(32.8)

0.94(0.53,1.66)

0.82

10(15.6)

0.97(0.45,2.10)

0.94

Extensive (E3)

43

18(41.9)

0.86(0.47,1.57)

0.62

17(39.5)

1.13(0.60,2.12)

0.70

8(18.6)

1.16(0.49,2.70)

0.74

Disease severity

180

88(48.9)

1(Reference)

 

63(35.0)

1(Reference)

 

29(16.1)

1(Reference)

 

Mild

76

35(46.1)

0.94(0.59,1.51)

0.81

28(36.8)

1.05(0.63,1.77)

0.85

13(17.1)

1.06(0.52,2.15)

0.87

Moderate

95

48(50.5)

1.03(0.67,1.59)

0.88

32(33.7)

0.96(0.59,1.58)

0.88

15(15.8)

0.98(0.50,1.92)

0.95

Severe

9

5(55.6)

1.14(0.37,3.49)

0.82

3(33.3)

0.95(0.25,3.63)

0.94

1(11.1)

0.69(0.08,5.65)

0.73

Abbreviations: OR odds ratio, CI confidence interval.

IL-22 +1995 A/C polymorphisms and UC

The IL-22 +1995 A/C gene polymorphisms were not associated with a risk of UC (Table 3). When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups (Table 6).
Table 6

Stratification analysis of IL-22 +1995 A/C polymorphisms in ulcerative colitis cases

 

Cases (n = 180)

AA

AC

CC

n (%)

OR (95% CI)

P

n (%)

OR (95% CI)

P

n (%)

OR (95% CI)

P

Clinical type

180

76(42.2)

1(Reference)

 

65(36.1)

1(Reference)

 

39(21.7)

1(Reference)

 

One episode

16

7(43.8)

1.04(0.41,2.62)

0.94

6(37.5)

1.04(0.39,2.77)

0.94

3(18.7)

0.87(0.24,3.12)

0.83

Relapsing

70

29(41.4)

0.98(0.59,1.63)

0.94

25(35.7)

0.99(0.58,1.69)

0.97

16(22.9)

1.06(0.55,2.01)

0.87

Continuous

94

40(42.6)

1.01(0.64,1.59)

0.97

34(36.2)

1.00(0.62,1.63)

0.99

20(21.2)

0.98(0.54,1.78)

0.95

Location

180

76(42.2)

1(Reference)

 

65(36.1)

1(Reference)

 

39(21.7)

1(Reference)

 

Proctitis (E1)

73

31(42.5)

1.01(0.61,1.66)

0.98

26(35.6)

0.99(0.58,1.68)

0.96

16(21.9)

1.01(0.53,1.92)

0.97

Left side (E2)

64

26(40.6)

0.96(0.57,1.63)

0.89

24(37.5)

1.04(0.60,1.80)

0.89

14(21.9)

1.01(0.52,1.98)

0.98

Extensive (E3)

43

19(44.2)

1.05(0.57,1.91)

0.88

15(34.9)

0.97(0.50,1.86)

0.92

9(20.9)

0.97(0.44,2.15)

0.93

Disease severity

180

76(42.2)

1(Reference)

 

65(36.1)

1(Reference)

 

39(21.7)

1(Reference)

 

Mild

76

33(43.4)

1.03(0.63,1.68)

0.91

27(35.5)

0.98(0.58,1.66)

0.95

16(21.1)

0.97(0.51,1.84)

0.93

Moderate

95

39(41.1)

0.97(0.61,1.54)

0.91

35(36.8)

1.02(0.63,1.65)

0.94

21(22.1)

1.02(0.57,1.83)

0.95

Severe

9

4(44.5)

1.05(0.32,3.52)

0.93

3(33.3)

0.92(0.24,3.52)

0.91

2(22.2)

1.03(0.21,4.93)

0.98

Discussion

Recently, many studies have identified many SNPs associated with UC. A case-control study in 139 and 176 patients with UC and controls found that polymorphisms in CD14-159 C/T and TLR4-299 A/G significantly affected mCD14 and mTLR4 expression levels and also increased susceptibility to UC [27]. A case-control study in a Korean population suggested that the -1920 G > A polymorphism in IFITM1 may be associated with susceptibility to UC (P = 0.002) [28]. A case-control study in a group of 198 Mexican Mestizo patients with UC and 698 ethnically matched healthy unrelated individuals with no family history of UC suggested that the GG genotypes of the IL-20 polymorphisms (rs2981573 and rs2232360) might have an important role in the development of UC (P = 0.017) in the Mexican population [29]. A case-control study in 56 patients with UC and 50 healthy controls suggested that the IL-10 -819 CC was a candidate genotype for both IBS (P = 0.047) and UC (P = 0.007) in Japanese [30]. A case-control study suggested that the −1850 G/C polymorphism in the embryonic ectoderm development (EED) gene might be associated with the susceptibility to UC (P = 0.018) by the change of the EED expression level [31]. A meta-analysis of seventeen studies with 18,308 cases and 20,406 controls indicated that the PTPN2 polymorphism (rs2542151) was associated with increased UC risk [32]. A meta-analysis of nine studies indicated that the vitamin D receptor (VDR) polymorphisms were associated with increased UC risk [33]. A meta-analysis suggested that the migration inhibitory factor (MIF) gene -173 G/C polymorphism contributed to the susceptibility of UC [34]. A case-control study included 422 very-early-onset IBD subjects and 480 healthy subjects suggested that IL-10R polymorphisms were associated with very-early-onset ulcerative colitis (P = 0.0002) [35]. A case-control study included 171 UC and 213 healthy controls found that polymorphisms in XRCC1 Arg399Gln and APE1 Asp148Glu significantly increased the rate of apoptosis and risk of UC (P = 0.0007) [36]. A case-control study in a group of 200 Mexican patients with UC and 248 ethnically matched unrelated healthy controls suggested that IL-1 RN and IL-1B polymorphisms were associated with the genetic susceptibility to develop UC and might be associated with the presence of steroid-dependence in UC patients (P = 0.019) [37]. A case-control study in a group of 200 Mexican Mestizo patients with UC and 698 healthy unrelated individuals with no family history of UC suggested that IL-19 polymorphisms (rs2243188 and rs2243193) might have a protective role in the development of UC (P = 0.018 and P = 0.006, respectively) in Mexican individuals [38].

IL-22 expression was involved in several human inflammatory conditions and autoimmune diseases. A study included 631 HCV patients found that IL-22 polymorphisms were involved in the progression of persistent hepatitis C virus infection [15]. A case-control study in 206 cases and 196 controls suggested that Polymorphisms in the IL-22 receptor alpha-1 gene were associated with severe chronic rhinosinusitis (P = 0.0014) [16]. A case-control study in 194 patients and 287 normal controls suggested that polymorphism of IL-22 receptor alpha-1 was associated with the development of childhood IgA nephropathy (P = 0.002) [22]. IL-22 deficiency may contribute to the pathogenesis of certain chronic disorders as postulated in this paper for acne inversa [39]. A study included 94 patients with COPD, 23 healthy smokers, and 22 healthy control non-smokers found that the increased sputum IL-22 might also play important roles in the pathogenesis of chronic obstructive pulmonary disease (P< 0.01) [40]. A case-control study indicated that there was an increased expression level of IL-22 and IL-23 in patients with peri-implantitis (P< 0.05) [41]. A study in 18 cases and 21 controls suggested that increased expression of IL-22 was associated with disease activity in Behcet s disease [42]. IL-22 has been reported to be involved in systemic sclerosis lesions [43]. A study included allergic asthma (n = 18), controlled asthma (n = 17) and healthy controls (n = 12) found that IL-22 might be involved in the pathogenesis of allergic asthma in human and the level of IL-22 might have some relationship with the severity of the disease (P< 0.05) [44].

Our results should be taken with caution for some limitations. First of all, the numbers of subjects included in this study were small, and may not have been sufficient to reveal the associations between the IL-22 gene polymorphisms (-429 C/T, +1046 T/A and +1995 A/C) and the risk of UC. Secondly, our investigation was not based on genome wide screening, but UC was induced by multiple genes and environmental factors, which were not explored in the present study. Thirdly, the participants in our research are only from Han Chinese ethnic group. It would be interesting to conduct similar studies in different populations for comparison. Finally, this is a hospital based case control study, so the selection bias cannot be avoidable and the subjects may not be representative of the general population.

Conclusions

In conclusion, this study provides evidence for an association of IL-22 -429 C/T gene polymorphisms with UC risk. To the best of our knowledge this is the first study to provide evidence about the role of IL-22 polymorphisms in the development of UC. Additional well-designed large-scale multicenter studies were required for the validation of our results.

Authors' information

Hong Gang Chi and Xue Bao Zheng are joint first authors.

Declarations

Acknowledgment

This investigation was funded by the National Natural Science Foundation of China (NSFC, No. 81173240), Science and Technology Planning Project of Guangdong Province (No. 2013B032500019), China and the PhD Start-up Fund of Guangdong Medical College (No. B2013005, B2013006).

Authors’ Affiliations

(1)
Department of Traditional Chinese Medicine, The Second Clinical Medical College, Guangdong Medical College
(2)
The Second Clinical Medical College, Guangdong Medical College
(3)
Emergency Department of Nanfang Hospital, Southern Medical University
(4)
Sino-American Cancer Research Institute, Guangdong Medical College

References

  1. Tyler AD, Milgrom R, Stempak JM, Xu W, Brumell JH, Muise AM, Sehgal R, Cohen Z, Koltun W, Shen B, Silverberg MS: The NOD2insC polymorphism is associated with worse outcome following ileal pouch-anal anastomosis for ulcerative colitis. Gut. 2013, 62: 1433-1439. 10.1136/gutjnl-2011-301957.PubMedView ArticleGoogle Scholar
  2. Danese S, Fiocchi C: Ulcerative colitis. N Engl J Med. 2011, 365: 1713-1725. 10.1056/NEJMra1102942.PubMedView ArticleGoogle Scholar
  3. Jess T, Rungoe C, Peyrin-Biroulet L: Risk of colorectal cancer in patients with ulcerative colitis: a meta-analysis of population-based cohort studies. Clin Gastroenterol Hepatol. 2012, 10: 639-645. 10.1016/j.cgh.2012.01.010.PubMedView ArticleGoogle Scholar
  4. Sartor RB: Mechanisms of disease: pathogenesis of Crohn s disease and ulcerative colitis. Nat Clin Pract Gastroenterol Hepatol. 2006, 3: 390-407. 10.1038/ncpgasthep0528.PubMedView ArticleGoogle Scholar
  5. Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA, Essers J, Mitrovic M, Ning K, Cleynen I, Theatre E, Spain SL, Raychaudhuri S, Goyette P, Wei Z, Abraham C, Achkar JP, Ahmad T, Amininejad L, Ananthakrishnan AN, Andersen V, Andrews JM, Baidoo L, Balschun T, Bampton PA, Bitton A, et al.: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature. 2012, 491: 119-124. 10.1038/nature11582.PubMedPubMed CentralView ArticleGoogle Scholar
  6. Beaudoin M, Goyette P, Boucher G, Lo KS, Rivas MA, Stevens C, Alikashani A, Ladouceur M, Ellinghaus D, Torkvist L, Goel G, Lagacé C, Annese V, Bitton A, Begun J, Brant SR, Bresso F, Cho JH, Duerr RH, Halfvarson J, McGovern DP, Radford-Smith G, Schreiber S, Schumm PL, Sharma Y, Silverberg MS, Weersma RK, et al.: Deep resequencing of GWAS loci identifies rare variants in CARD9, IL23R and RNF186 that are associated with Ulcerative colitis. Plos Genet. 2013, 9: e1003723-10.1371/journal.pgen.1003723.PubMedPubMed CentralView ArticleGoogle Scholar
  7. Anderson CA, Boucher G, Lees CW, Franke A, D'Amato M, Taylor KD, Lee JC, Goyette P, Imielinski M, Latiano A, Lagacé C, Scott R, Amininejad L, Bumpstead S, Baidoo L, Baldassano RN, Barclay M, Bayless TM, Brand S, Büning C, Colombel JF, Denson LA, De Vos M, Dubinsky M, Edwards C, Ellinghaus D, Fehrmann RS, Floyd JA, Florin T, Franchimont D, et al.: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat Genet. 2011, 43: 246-252. 10.1038/ng.764.PubMedPubMed CentralView ArticleGoogle Scholar
  8. Andoh A, Zhang Z, Inatomi O, Fujino S, Deguchi Y, Araki Y, Tsujikawa T, Kitoh K, Kim-Mitsuyama S, Takayanagi A, Shimizu N, Fujiyama Y: Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts. Gastroenterology. 2005, 129: 969-984. 10.1053/j.gastro.2005.06.071.PubMedView ArticleGoogle Scholar
  9. Wolk K, Sabat R: Interleukin-22: a novel T- and NK-cell derived cytokine that regulates the biology of tissue cells. Cytokine Growth Factor Rev. 2006, 17: 367-380. 10.1016/j.cytogfr.2006.09.001.PubMedView ArticleGoogle Scholar
  10. Wolk K, Kunz S, Witte E, Friedrich M, Asadullah K, Sabat R: IL-22 increases the innate immunity of tissues. Immunity. 2004, 21: 241-254. 10.1016/j.immuni.2004.07.007.PubMedView ArticleGoogle Scholar
  11. Boniface K, Bernard FX, Garcia M, Gurney AL, Lecron JC, Morel F: IL-22 inhibits epidermal differentiation and induces proinflammatory gene expression and migration of human keratinocytes. J Immunol. 2005, 174: 3695-3702. 10.4049/jimmunol.174.6.3695.PubMedView ArticleGoogle Scholar
  12. Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Stevens S, Flavell RA: Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. Immunity. 2008, 29: 947-957. 10.1016/j.immuni.2008.11.003.PubMedPubMed CentralView ArticleGoogle Scholar
  13. Yu LZ, Wang HY, Yang SP, Yuan ZP, Xu FY, Sun C, Shi RH: Expression of interleukin-22/STAT3 signaling pathway in ulcerative colitis and related carcinogenesis. World J Gastroenterol. 2013, 19: 2638-2649. 10.3748/wjg.v19.i17.2638.PubMedPubMed CentralView ArticleGoogle Scholar
  14. Yamamoto-Furusho JK, Miranda-Perez E, Fonseca-Camarillo G, Sanchez-Munoz F, Dominguez-Lopez A, Barreto-Zuniga R: Colonic epithelial upregulation of interleukin 22 (IL-22) in patients with ulcerative colitis. Inflamm Bowel Dis. 2010, 16: 1823-10.1002/ibd.21235.PubMedView ArticleGoogle Scholar
  15. Hennig BJ, Frodsham AJ, Hellier S, Knapp S, Yee LJ, Wright M, Zhang L, Thomas HC, Thursz M, Hill AV: Influence of IL-10RA and IL-22 polymorphisms on outcome of hepatitis C virus infection. Liver Int. 2007, 27: 1134-1143. 10.1111/j.1478-3231.2007.01518.x.PubMedView ArticleGoogle Scholar
  16. Endam LM, Bosse Y, Filali-Mouhim A, Cormier C, Boisvert P, Boulet LP, Hudson TJ, Desrosiers M: Polymorphisms in the interleukin-22 receptor alpha-1 gene are associated with severe chronic rhinosinusitis. Otolaryngol Head Neck Surg. 2009, 140: 741-747. 10.1016/j.otohns.2008.12.058.PubMedView ArticleGoogle Scholar
  17. Weger W, Hofer A, Wolf P, El-Shabrawi Y, Renner W, Kerl H, Salmhofer W: Common polymorphisms in the interleukin-22 gene are not associated with chronic plaque psoriasis. Exp Dermatol. 2009, 18: 796-798. 10.1111/j.1600-0625.2009.00840.x.PubMedView ArticleGoogle Scholar
  18. Thompson CL, Plummer SJ, Tucker TC, Casey G, Li L: Interleukin-22 genetic polymorphisms and risk of colon cancer. Cancer Causes Control. 2010, 21: 1165-1170. 10.1007/s10552-010-9542-5.PubMedView ArticleGoogle Scholar
  19. Ding GG, Zhang GL, Chen XC, Zhang MX, Yang L, Wang Z: A study on the relationship between single nucleotide polymorphisms of interleukin-22 and susceptibility to pulmonary tuberculosis. Zhonghua Jie He He Hu Xi Za Zhi. 2012, 35: 596-600.PubMedGoogle Scholar
  20. Musolino C, Allegra A, Ferraro M, Aguennouz M, Russo S, Alonci A, Saitta S, Gangemi S: Involvement of T2677T multidrug resistance gene polymorphism in Interleukin 22 plasma concentration in B-chronic lymphocytic leukemia patients. Acta Oncol. 2012, 51: 406-408. 10.3109/0284186X.2011.631577.PubMedView ArticleGoogle Scholar
  21. Eun YG, Shin IH, Lee YC, Shin SY, Kim SK, Chung JH, Kwon KH: Interleukin 22 polymorphisms and papillary thyroid cancer. J Endocrinol Invest. 2013, 36: 584-587.PubMedGoogle Scholar
  22. Suh JS, Cho SH, Chung JH, Moon A, Park YK, Cho BS: A polymorphism of interleukin-22 receptor alpha-1 is associated with the development of childhood IgA nephropathy. J Interferon Cytokine Res. 2013, 33: 571-577. 10.1089/jir.2012.0097.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Podolsky DK: Inflammatory bowel disease. N Engl J Med. 2002, 347: 417-429. 10.1056/NEJMra020831.PubMedView ArticleGoogle Scholar
  24. Satsangi J, Silverberg MS, Vermeire S, Colombel JF: The Montreal classification of inflammatory bowel disease: controversies, consensus, and implications. Gut. 2006, 55: 749-753. 10.1136/gut.2005.082909.PubMedPubMed CentralView ArticleGoogle Scholar
  25. Truelove SC, Witts LJ: Cortisone in ulcerative colitis; final report on a therapeutic trial. Br Med J. 1955, 2: 1041-1048. 10.1136/bmj.2.4947.1041.PubMedPubMed CentralView ArticleGoogle Scholar
  26. Langholz E, Munkholm P, Davidsen M, Binder V: Course of ulcerative colitis: analysis of changes in disease activity over years. Gastroenterology. 1994, 107: 3-11.PubMedGoogle Scholar
  27. Sivaram G, Tiwari SK, Bardia A, Anjum F, Vishnupriya S, Habeeb A, Khan AA: Macrophage migration inhibitory factor, Toll-like receptor 4, and CD14 polymorphisms with altered expression levels in patients with ulcerative colitis. Hum Immunol. 2012, 73: 201-205. 10.1016/j.humimm.2011.12.006.PubMedView ArticleGoogle Scholar
  28. Mo JS, Na KS, Yu JI, Chae SC: Identification of the polymorphisms in IFITM1 gene and their association in a Korean population with ulcerative colitis. Immunol Lett. 2013, 156: 118-122. 10.1016/j.imlet.2013.09.026.PubMedView ArticleGoogle Scholar
  29. Yamamoto-Furusho JK, De-Leon-Rendon JL, de la Torre MG, Alvarez-Leon E, Vargas-Alarcon G: Genetic polymorphisms of interleukin 20 (IL-20) in patients with ulcerative colitis. Immunol Lett. 2013, 149: 50-53. 10.1016/j.imlet.2012.11.008.PubMedView ArticleGoogle Scholar
  30. Shiotani A, Kusunoki H, Kimura Y, Ishii M, Imamura H, Tarumi K, Manabe N, Kamada T, Hata J, Haruma K: S100A expression and interleukin-10 polymorphisms are associated with Ulcerative colitis and diarrhea predominant irritable bowel syndrome. Dig Dis Sci. 2013, 58: 2314-2323. 10.1007/s10620-013-2677-y.PubMedView ArticleGoogle Scholar
  31. Yu JI, Kang IH, Seo GS, Choi SC, Yun KJ, Chae SC: Promoter polymorphism of the EED gene is associated with the susceptibility to Ulcerative colitis. Dig Dis Sci. 2012, 57: 1537-1543. 10.1007/s10620-012-2045-3.PubMedView ArticleGoogle Scholar
  32. Zhang JX, He JH, Wang J, Song J, Lei HB, Wang J, Dong WG: Associations between PTPN2 polymorphisms and susceptibility to ulcerative colitis and Crohn s disease: a meta-analysis. Inflamm Res. 2014, 63: 71-79. 10.1007/s00011-013-0673-5.PubMedView ArticleGoogle Scholar
  33. Xue LN, Xu KQ, Zhang W, Wang Q, Wu J, Wang XY: Associations between vitamin D receptor polymorphisms and susceptibility to Ulcerative colitis and Crohn s disease: a meta-analysis. Inflamm Bowel Dis. 2013, 19: 54-60. 10.1002/ibd.22966.PubMedView ArticleGoogle Scholar
  34. Wang B, Zhao XP, Fan YC, Zhang JJ, Zhao J, Wang K: IL-17A but not IL-22 suppresses the replication of hepatitis B virus mediated by over-expression of MxA and OAS mRNA in the HepG2.2.15 cell line. Antiviral Res. 2013, 97: 285-292. 10.1016/j.antiviral.2012.12.018.PubMedView ArticleGoogle Scholar
  35. Moran CJ, Walters TD, Guo CH, Kugathasan S, Klein C, Turner D, Wolters VM, Bandsma RH, Mouzaki M, Zachos M, Langer JC, Cutz E, Benseler SM, Roifman CM, Silverberg MS, Griffiths AM, Snapper SB, Muise AM: IL-10R polymorphisms are associated with very-early-onset Ulcerative colitis. Inflamm Bowel Dis. 2013, 19: 115-123. 10.1002/ibd.22974.PubMedPubMed CentralView ArticleGoogle Scholar
  36. Bardia A, Tiwari SK, Gunisetty S, Anjum F, Nallari P, Habeeb MA, Khan AA: Functional polymorphisms in XRCC-1 and APE-1 contribute to increased apoptosis and risk of ulcerative colitis. Inflamm Res. 2012, 61: 359-365. 10.1007/s00011-011-0418-2.PubMedView ArticleGoogle Scholar
  37. Yamamoto-Furusho JK, Santiago-Hernandez JJ, Perez-Hernandez N, Ramirez-Fuentes S, Fragoso JM, Vargas-Alarcon G: Interleukin 1 beta (IL-1B) and IL-1 antagonist receptor (IL-1RN) gene polymorphisms are associated with the genetic susceptibility and steroid dependence in patients with Ulcerative colitis. J Clin Gastroenterol. 2011, 45: 531-535. 10.1097/MCG.0b013e3181faec51.PubMedView ArticleGoogle Scholar
  38. Yamamoto-Furusho JK, Alvarez-Leon E, Fragoso JM, Gozalishvilli A, Vallejo M, Vargas-Alarcon G: Protective role of interleukin-19 gene polymorphisms in patients with ulcerative colitis. Hum Immunol. 2011, 72: 1029-1032. 10.1016/j.humimm.2011.08.013.PubMedView ArticleGoogle Scholar
  39. Wolk K, Warszawska K, Hoeflich C, Witte E, Schneider-Burrus S, Witte K, Kunz S, Buss A, Roewert HJ, Krause M, Lukowsky A, Volk HD, Sterry W, Sabat R: Deficiency of IL-22 contributes to a chronic inflammatory disease: pathogenetic mechanisms in acne inversa. J Immunol. 2011, 186: 1228-1239. 10.4049/jimmunol.0903907.PubMedView ArticleGoogle Scholar
  40. Zhang L, Cheng Z, Liu W, Wu K: Expression of interleukin (IL)-10, IL-17A and IL-22 in serum and sputum of stable chronic obstructive pulmonary disease patients. COPD. 2013, 10: 459-465. 10.3109/15412555.2013.770456.PubMedView ArticleGoogle Scholar
  41. Luo Z, Wang H, Sun Z, Luo W, Wu Y: Expression of IL-22, IL-22R and IL-23 in the peri-implant soft tissues of patients with peri-implantitis. Arch Oral Biol. 2013, 58: 523-529. 10.1016/j.archoralbio.2012.08.006.PubMedView ArticleGoogle Scholar
  42. Cai T, Wang Q, Zhou Q, Wang C, Hou S, Qi J, Kijlstra A, Yang P: Increased expression of IL-22 is associated with disease activity in Behcet s disease. PLoS One. 2013, 8: e59009-10.1371/journal.pone.0059009.PubMedPubMed CentralView ArticleGoogle Scholar
  43. Mathian A, Parizot C, Dorgham K, Trad S, Arnaud L, Larsen M, Miyara M, Hie M, Piette JC, Frances C, Yssel H, Amoura Z, Gorochov G: Activated and resting regulatory T cell exhaustion concurs with high levels of interleukin-22 expression in systemic sclerosis lesions. Ann Rheum Dis. 2012, 71: 1227-1234. 10.1136/annrheumdis-2011-200709.PubMedView ArticleGoogle Scholar
  44. Zhu J, Cao Y, Li K, Wang Z, Zuo P, Xiong W, Xu Y, Xiong S: Increased expression of aryl hydrocarbon receptor and interleukin 22 in patients with allergic asthma. Asian Pac J Allergy Immunol. 2011, 29: 266-272.PubMedGoogle Scholar

Copyright

© Chi et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement